Incidental Mutation 'R6562:Dock7'
ID522430
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98991410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 969 (V969D)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000127946] [ENSMUST00000205650]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030286
AA Change: V999D

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: V999D

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: V969D
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: V969D

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124466
AA Change: V385D
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: V999D
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: V999D

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127946
AA Change: V242D
SMART Domains Protein: ENSMUSP00000119103
Gene: ENSMUSG00000028556
AA Change: V242D

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150254
AA Change: V223D
SMART Domains Protein: ENSMUSP00000114204
Gene: ENSMUSG00000028556
AA Change: V223D

DomainStartEndE-ValueType
low complexity region 74 84 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205650
AA Change: V969D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205783
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7729:Dock7 UTSW 4 99055446 missense
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATATTGTGTTGGTACCCATGGCC -3'
(R):5'- TGGGTGTGTCCATGACATCATC -3'

Sequencing Primer
(F):5'- GGTACCCATGGCCTATATTTAGAAGC -3'
(R):5'- GTGTGTCCATGACATCATCCAGTG -3'
Posted On2018-06-06