Incidental Mutation 'R6532:Nlk'
ID522436
Institutional Source Beutler Lab
Gene Symbol Nlk
Ensembl Gene ENSMUSG00000017376
Gene Namenemo like kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6532 (G1)
Quality Score125.008
Status Validated
Chromosome11
Chromosomal Location78567168-78697373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78696055 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 71 (A71E)
Ref Sequence ENSEMBL: ENSMUSP00000119345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142739]
Predicted Effect probably damaging
Transcript: ENSMUST00000142739
AA Change: A71E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119345
Gene: ENSMUSG00000017376
AA Change: A71E

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 27 55 N/A INTRINSIC
low complexity region 97 119 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
S_TKc 138 427 3.36e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165271
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation die either during late gestation or around 4-6 weeks, depending on background. Long survivors exhibit growth retardation, neurological abnormalities, and aberrant differentiation of bone marrow stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,977,379 L1418P probably damaging Het
Adal A G 2: 121,146,123 probably null Het
Akap2 T C 4: 57,855,174 F168L probably benign Het
Atr T A 9: 95,908,408 N1600K probably benign Het
Cubn T C 2: 13,459,002 T631A probably benign Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Ear1 C T 14: 43,819,252 R53H probably benign Het
Exoc1 T C 5: 76,537,837 V132A probably damaging Het
Fam227a C T 15: 79,636,720 R301Q probably benign Het
Garnl3 A T 2: 33,031,119 M298K possibly damaging Het
Glb1l3 T C 9: 26,818,442 D619G probably benign Het
Haspin A T 11: 73,137,551 C237* probably null Het
Hook1 T G 4: 96,019,756 probably null Het
Hoxa7 A G 6: 52,217,315 F31L probably benign Het
Hoxb7 C A 11: 96,286,888 S54* probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Inca1 T C 11: 70,695,907 M1V probably null Het
Kcnt2 A G 1: 140,584,106 T933A probably damaging Het
Lama4 G A 10: 39,048,077 D494N possibly damaging Het
Lrp1 A C 10: 127,541,682 H4133Q probably damaging Het
Lrp1 A G 10: 127,549,407 F3542L probably damaging Het
Myo1f A G 17: 33,575,846 D20G probably damaging Het
Nvl G A 1: 181,144,143 probably null Het
Olfr1154 A T 2: 87,903,202 I158N probably damaging Het
Pcnx C A 12: 81,980,964 H1601N probably damaging Het
Pnkp T A 7: 44,857,405 M1K probably null Het
Skiv2l G A 17: 34,844,743 R575C probably damaging Het
Slc25a54 A G 3: 109,112,052 Y324C probably damaging Het
Tdrd3 A G 14: 87,505,816 E400G probably damaging Het
Unc5b A G 10: 60,778,828 I230T possibly damaging Het
Wfdc2 A G 2: 164,563,376 T50A probably benign Het
Zfp563 A G 17: 33,105,698 I422M probably benign Het
Other mutations in Nlk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Nlk APN 11 78589375 missense probably damaging 1.00
IGL02186:Nlk APN 11 78586936 missense probably damaging 1.00
IGL02336:Nlk APN 11 78586937 missense probably damaging 1.00
IGL02739:Nlk APN 11 78574851 missense probably benign 0.05
IGL02953:Nlk APN 11 78626701 missense probably benign 0.02
Verne UTSW 11 78587066 nonsense probably null
R0276:Nlk UTSW 11 78571475 missense probably benign 0.01
R0324:Nlk UTSW 11 78572431 missense possibly damaging 0.71
R0636:Nlk UTSW 11 78695844 missense probably benign 0.34
R0639:Nlk UTSW 11 78572277 missense possibly damaging 0.86
R1776:Nlk UTSW 11 78587027 missense probably benign 0.03
R1886:Nlk UTSW 11 78586928 missense probably damaging 1.00
R4330:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R4331:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R5974:Nlk UTSW 11 78590966 missense probably benign 0.39
R6669:Nlk UTSW 11 78587066 nonsense probably null
R6873:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R7165:Nlk UTSW 11 78590967 nonsense probably null
R7475:Nlk UTSW 11 78583399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAATTGGTCTATCCGGCTC -3'
(R):5'- TGATGGCGGCTTACAATGG -3'

Sequencing Primer
(F):5'- GGTCTATCCGGCTCAATGTCCAG -3'
(R):5'- TACAATGGCGGTACATCTGC -3'
Posted On2018-06-06