Incidental Mutation 'R6532:Tdrd3'
ID 522446
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Name tudor domain containing 3
Synonyms 4732418C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R6532 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 87416639-87545504 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87505816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 400 (E400G)
Ref Sequence ENSEMBL: ENSMUSP00000131542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
AlphaFold Q91W18
Predicted Effect probably damaging
Transcript: ENSMUST00000168275
AA Change: E400G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: E400G

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169504
AA Change: E400G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: E400G

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170865
AA Change: E394G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: E394G

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,977,379 L1418P probably damaging Het
Adal A G 2: 121,146,123 probably null Het
Akap2 T C 4: 57,855,174 F168L probably benign Het
Atr T A 9: 95,908,408 N1600K probably benign Het
Cubn T C 2: 13,459,002 T631A probably benign Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Ear1 C T 14: 43,819,252 R53H probably benign Het
Exoc1 T C 5: 76,537,837 V132A probably damaging Het
Fam227a C T 15: 79,636,720 R301Q probably benign Het
Garnl3 A T 2: 33,031,119 M298K possibly damaging Het
Glb1l3 T C 9: 26,818,442 D619G probably benign Het
Haspin A T 11: 73,137,551 C237* probably null Het
Hook1 T G 4: 96,019,756 probably null Het
Hoxa7 A G 6: 52,217,315 F31L probably benign Het
Hoxb7 C A 11: 96,286,888 S54* probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Inca1 T C 11: 70,695,907 M1V probably null Het
Kcnt2 A G 1: 140,584,106 T933A probably damaging Het
Lama4 G A 10: 39,048,077 D494N possibly damaging Het
Lrp1 A C 10: 127,541,682 H4133Q probably damaging Het
Lrp1 A G 10: 127,549,407 F3542L probably damaging Het
Myo1f A G 17: 33,575,846 D20G probably damaging Het
Nlk G T 11: 78,696,055 A71E probably damaging Het
Nvl G A 1: 181,144,143 probably null Het
Olfr1154 A T 2: 87,903,202 I158N probably damaging Het
Pcnx C A 12: 81,980,964 H1601N probably damaging Het
Pnkp T A 7: 44,857,405 M1K probably null Het
Skiv2l G A 17: 34,844,743 R575C probably damaging Het
Slc25a54 A G 3: 109,112,052 Y324C probably damaging Het
Unc5b A G 10: 60,778,828 I230T possibly damaging Het
Wfdc2 A G 2: 164,563,376 T50A probably benign Het
Zfp563 A G 17: 33,105,698 I422M probably benign Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
R8985:Tdrd3 UTSW 14 87506161 missense possibly damaging 0.69
R9081:Tdrd3 UTSW 14 87506281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACTAGAACTCAGAGGATGCTG -3'
(R):5'- CAGAACCTGAGGAACTACTCGG -3'

Sequencing Primer
(F):5'- AAAGTATGGAGATAGGAGATGTTACC -3'
(R):5'- TGAGGAACTACTCGGCCTTTCG -3'
Posted On 2018-06-06