Incidental Mutation 'R6488:Ankar'
ID 522462
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6488 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 72681808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably null
Transcript: ENSMUST00000053499
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211837
Predicted Effect probably null
Transcript: ENSMUST00000212573
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
4933406M09Rik T A 1: 134,390,888 V466D probably damaging Het
Abhd15 T C 11: 77,516,022 F275S possibly damaging Het
Adamts7 A G 9: 90,171,482 T27A probably benign Het
Ap2a2 T C 7: 141,602,307 V183A probably benign Het
Arhgef37 G A 18: 61,518,052 A134V probably benign Het
Col3a1 C A 1: 45,331,534 probably benign Het
Cxcr5 A G 9: 44,513,979 V127A probably damaging Het
Eif4b T A 15: 102,092,987 probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fam83h T C 15: 76,002,053 E1145G possibly damaging Het
Fcgbp A G 7: 28,093,538 D989G probably damaging Het
Fchsd1 T C 18: 37,967,268 probably null Het
Fcnb T C 2: 28,078,289 K219E probably damaging Het
Fndc7 T C 3: 108,870,575 E355G probably damaging Het
Glis3 T C 19: 28,298,853 H746R probably benign Het
Glod4 A G 11: 76,237,785 V74A probably damaging Het
Gm10436 T C 12: 88,177,587 H152R possibly damaging Het
Gpc6 T C 14: 117,964,713 I445T possibly damaging Het
Hdlbp T C 1: 93,428,224 D337G probably damaging Het
Hnf1a T C 5: 114,955,961 T190A probably benign Het
Iqgap1 G C 7: 80,730,326 T1129R probably benign Het
Kcnc3 T C 7: 44,595,182 F299L possibly damaging Het
Kif1bp C A 10: 62,559,658 probably null Het
Kif26b T C 1: 178,529,573 V4A unknown Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap4-1 G T 11: 99,628,077 R36S unknown Het
Lman1l A G 9: 57,620,643 S10P possibly damaging Het
Lrpprc T C 17: 84,751,353 N693S probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mga T A 2: 119,960,907 N2424K probably damaging Het
Mpdz G T 4: 81,287,733 A1784E probably benign Het
Mpv17l G A 16: 13,946,588 probably null Het
Mtus1 G A 8: 41,041,508 S29L possibly damaging Het
Myo15 A T 11: 60,478,487 H691L possibly damaging Het
Nbea T C 3: 55,717,843 T2276A probably damaging Het
Npas4 A G 19: 4,985,983 S718P probably damaging Het
Ntrk2 T A 13: 58,861,356 N320K possibly damaging Het
Nup214 T A 2: 31,991,372 I414N possibly damaging Het
Oas2 A G 5: 120,738,363 F15S probably damaging Het
Olfr1474 T C 19: 13,471,617 Y216H probably damaging Het
Olfr625-ps1 T C 7: 103,683,078 I110T probably damaging Het
Pabpc6 A G 17: 9,669,599 Y8H probably damaging Het
Pbx1 T A 1: 168,191,395 N294Y probably damaging Het
Pcyt1a T C 16: 32,467,081 M190T probably damaging Het
Pogk T C 1: 166,399,422 I387V possibly damaging Het
Ppp6r2 T C 15: 89,268,538 L294P probably benign Het
Ptprn2 T A 12: 116,872,038 I331K probably benign Het
Ptpro T G 6: 137,393,675 Y591* probably null Het
Ptprz1 T A 6: 23,001,517 L1202* probably null Het
Rab37 A G 11: 115,157,963 T73A probably benign Het
Rad51ap2 T G 12: 11,458,160 S694R possibly damaging Het
Rb1cc1 T A 1: 6,270,727 D148E probably damaging Het
Rraga G A 4: 86,576,328 R137H probably damaging Het
Serpinf2 A G 11: 75,437,503 V73A probably benign Het
Siglec1 T C 2: 131,081,307 N506S probably damaging Het
Slc35e4 T C 11: 3,912,602 T196A possibly damaging Het
St6galnac3 C T 3: 153,411,757 A110T probably damaging Het
Thsd1 T C 8: 22,243,717 V260A probably benign Het
Tpbg T A 9: 85,844,485 V169D possibly damaging Het
Trav16n A G 14: 53,351,585 E106G probably benign Het
Vmn1r219 T C 13: 23,162,965 I108T probably benign Het
Vmn2r50 T C 7: 10,037,717 I686V probably damaging Het
Zdhhc20 C T 14: 57,840,832 R329K probably benign Het
Zfp64 A G 2: 168,935,209 probably null Het
Zfp941 C T 7: 140,812,750 R232H probably benign Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TATCTGGTGCTAGGGCCTGAAC -3'
(R):5'- GCTACTATGTGATCCATTTTGAGCTTG -3'

Sequencing Primer
(F):5'- TAGGGCCTGAACTCTCTGAG -3'
(R):5'- GAGCTTGAAATTTTCTACCAGCAAC -3'
Posted On 2018-06-06