Incidental Mutation 'R6562:Pgghg'
ID522463
Institutional Source Beutler Lab
Gene Symbol Pgghg
Ensembl Gene ENSMUSG00000062031
Gene Nameprotein glucosylgalactosylhydroxylysine glucosidase
Synonyms5730511L01Rik, Athl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140941391-140947664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140946593 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 633 (I633V)
Ref Sequence ENSEMBL: ENSMUSP00000128214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000079403] [ENSMUST00000163094] [ENSMUST00000164580] [ENSMUST00000211129]
Predicted Effect probably benign
Transcript: ENSMUST00000026562
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079403
AA Change: I633V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031
AA Change: I633V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164337
SMART Domains Protein: ENSMUSP00000127119
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 219 464 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164580
AA Change: I633V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031
AA Change: I633V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169736
Predicted Effect probably benign
Transcript: ENSMUST00000211129
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Pgghg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Pgghg APN 7 140945351 critical splice donor site probably null
IGL00848:Pgghg APN 7 140942404 missense probably damaging 1.00
IGL01903:Pgghg APN 7 140946828 missense probably benign 0.03
IGL02060:Pgghg APN 7 140946633 missense probably benign 0.30
IGL02475:Pgghg APN 7 140945720 missense
IGL02519:Pgghg APN 7 140944981 missense possibly damaging 0.94
IGL02612:Pgghg APN 7 140946338 missense probably damaging 1.00
R0689:Pgghg UTSW 7 140943278 missense probably benign 0.08
R1696:Pgghg UTSW 7 140945311 missense possibly damaging 0.55
R1960:Pgghg UTSW 7 140943347 missense probably benign
R2110:Pgghg UTSW 7 140943540 missense possibly damaging 0.72
R3809:Pgghg UTSW 7 140945295 missense probably damaging 1.00
R3890:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R3891:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R4622:Pgghg UTSW 7 140941496 unclassified probably null
R5009:Pgghg UTSW 7 140943390 missense probably benign
R5058:Pgghg UTSW 7 140942542 missense possibly damaging 0.46
R5215:Pgghg UTSW 7 140946564 missense possibly damaging 0.64
R6122:Pgghg UTSW 7 140943395 missense possibly damaging 0.87
R6269:Pgghg UTSW 7 140946184 missense probably damaging 0.97
R6301:Pgghg UTSW 7 140946376 missense probably damaging 1.00
R7054:Pgghg UTSW 7 140944718 missense probably benign 0.15
R7241:Pgghg UTSW 7 140945720 missense
R7320:Pgghg UTSW 7 140943040 missense probably benign 0.44
R7486:Pgghg UTSW 7 140942480 missense probably benign
R7665:Pgghg UTSW 7 140945469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAACTTCTTGACTGGCATG -3'
(R):5'- AGACATGGACCAAGACATCTGG -3'

Sequencing Primer
(F):5'- ACTCTTCGGGTGCACAGGATTC -3'
(R):5'- AGACATCTGGGTCACACGC -3'
Posted On2018-06-06