Incidental Mutation 'R6562:Zcchc14'
ID522469
Institutional Source Beutler Lab
Gene Symbol Zcchc14
Ensembl Gene ENSMUSG00000061410
Gene Namezinc finger, CCHC domain containing 14
SynonymsBdg29
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location121598703-121652901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121604103 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 840 (N840K)
Ref Sequence ENSEMBL: ENSMUSP00000040360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046386] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000046386
AA Change: N840K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040360
Gene: ENSMUSG00000061410
AA Change: N840K

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
low complexity region 206 225 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Blast:SAM 299 349 2e-25 BLAST
SCOP:d1kw4a_ 307 358 1e-6 SMART
low complexity region 422 432 N/A INTRINSIC
low complexity region 438 454 N/A INTRINSIC
low complexity region 532 543 N/A INTRINSIC
low complexity region 709 790 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
ZnF_C2HC 914 930 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139379
Predicted Effect unknown
Transcript: ENSMUST00000154725
AA Change: N137K
SMART Domains Protein: ENSMUSP00000120570
Gene: ENSMUSG00000061410
AA Change: N137K

DomainStartEndE-ValueType
low complexity region 7 88 N/A INTRINSIC
low complexity region 89 106 N/A INTRINSIC
ZnF_C2HC 212 228 3.44e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Zcchc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Zcchc14 APN 8 121604615 unclassified probably benign
IGL02060:Zcchc14 APN 8 121603895 missense probably damaging 0.98
IGL02455:Zcchc14 APN 8 121606270 unclassified probably benign
IGL03196:Zcchc14 APN 8 121609138 unclassified probably benign
P0033:Zcchc14 UTSW 8 121610159 intron probably benign
R0483:Zcchc14 UTSW 8 121628649 intron probably benign
R0639:Zcchc14 UTSW 8 121605449 nonsense probably null
R1013:Zcchc14 UTSW 8 121606925 unclassified probably benign
R1129:Zcchc14 UTSW 8 121608415 unclassified probably benign
R1546:Zcchc14 UTSW 8 121604263 intron probably benign
R1563:Zcchc14 UTSW 8 121603979 missense probably benign 0.10
R1861:Zcchc14 UTSW 8 121609251 unclassified probably benign
R2200:Zcchc14 UTSW 8 121605428 unclassified probably benign
R2419:Zcchc14 UTSW 8 121603936 missense probably damaging 0.99
R4246:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4249:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4424:Zcchc14 UTSW 8 121651941 intron probably benign
R4470:Zcchc14 UTSW 8 121651759 intron probably benign
R4520:Zcchc14 UTSW 8 121609095 unclassified probably benign
R4681:Zcchc14 UTSW 8 121608600 unclassified probably benign
R5253:Zcchc14 UTSW 8 121618694 intron probably benign
R5314:Zcchc14 UTSW 8 121608598 unclassified probably benign
R5591:Zcchc14 UTSW 8 121605448 unclassified probably benign
R5746:Zcchc14 UTSW 8 121604639 unclassified probably benign
R5781:Zcchc14 UTSW 8 121604593 unclassified probably benign
R5897:Zcchc14 UTSW 8 121605160 unclassified probably benign
R5930:Zcchc14 UTSW 8 121611358 intron probably benign
R5963:Zcchc14 UTSW 8 121628623 intron probably benign
R6364:Zcchc14 UTSW 8 121604859 unclassified probably benign
R6579:Zcchc14 UTSW 8 121604467 intron probably benign
R6592:Zcchc14 UTSW 8 121604639 unclassified probably benign
R6699:Zcchc14 UTSW 8 121608616 unclassified probably benign
R7195:Zcchc14 UTSW 8 121608461 missense unknown
R7420:Zcchc14 UTSW 8 121651791 intron probably benign
R7490:Zcchc14 UTSW 8 121605017 missense unknown
R7597:Zcchc14 UTSW 8 121608500 missense unknown
R7758:Zcchc14 UTSW 8 121604689 missense unknown
R7773:Zcchc14 UTSW 8 121651775 missense unknown
Predicted Primers PCR Primer
(F):5'- CACAGTTGTAACAGGACAGATTCC -3'
(R):5'- ATTCCTGCCTCAAGCCAGAG -3'

Sequencing Primer
(F):5'- ACTGGAGCCATTGGTGC -3'
(R):5'- CTCAAGCCAGAGCCACC -3'
Posted On2018-06-06