Incidental Mutation 'R6488:Kif26b'
ID 522472
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Name kinesin family member 26B
Synonyms D230039L06Rik, N-11 kinesin
MMRRC Submission 044620-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6488 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 178356690-178766765 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 178357138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 4 (V4A)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161017]
AlphaFold Q7TNC6
Predicted Effect unknown
Transcript: ENSMUST00000161017
AA Change: V4A
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: V4A

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193931
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,275,298 (GRCm39) Q334* probably null Het
Abhd15 T C 11: 77,406,848 (GRCm39) F275S possibly damaging Het
Adamts7 A G 9: 90,053,535 (GRCm39) T27A probably benign Het
Ankar A G 1: 72,720,967 (GRCm39) probably null Het
Ap2a2 T C 7: 141,182,220 (GRCm39) V183A probably benign Het
Arhgef37 G A 18: 61,651,123 (GRCm39) A134V probably benign Het
Col3a1 C A 1: 45,370,694 (GRCm39) probably benign Het
Cplx3 A G 9: 57,527,926 (GRCm39) S10P possibly damaging Het
Cxcr5 A G 9: 44,425,276 (GRCm39) V127A probably damaging Het
Eif4b T A 15: 102,001,422 (GRCm39) probably benign Het
Ext2 A G 2: 93,636,430 (GRCm39) V228A probably damaging Het
Fam83h T C 15: 75,873,902 (GRCm39) E1145G possibly damaging Het
Fcgbp A G 7: 27,792,963 (GRCm39) D989G probably damaging Het
Fchsd1 T C 18: 38,100,321 (GRCm39) probably null Het
Fcnb T C 2: 27,968,301 (GRCm39) K219E probably damaging Het
Fndc7 T C 3: 108,777,891 (GRCm39) E355G probably damaging Het
Glis3 T C 19: 28,276,253 (GRCm39) H746R probably benign Het
Glod4 A G 11: 76,128,611 (GRCm39) V74A probably damaging Het
Gpc6 T C 14: 118,202,125 (GRCm39) I445T possibly damaging Het
Hdlbp T C 1: 93,355,946 (GRCm39) D337G probably damaging Het
Hnf1a T C 5: 115,094,020 (GRCm39) T190A probably benign Het
Iqgap1 G C 7: 80,380,074 (GRCm39) T1129R probably benign Het
Kcnc3 T C 7: 44,244,606 (GRCm39) F299L possibly damaging Het
Kifbp C A 10: 62,395,437 (GRCm39) probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Krtap4-1 G T 11: 99,518,903 (GRCm39) R36S unknown Het
Lrpprc T C 17: 85,058,781 (GRCm39) N693S probably damaging Het
Lrrc49 A T 9: 60,509,916 (GRCm39) F157L probably damaging Het
Mettl22 T C 16: 8,305,225 (GRCm39) F293L probably damaging Het
Mga T A 2: 119,791,388 (GRCm39) N2424K probably damaging Het
Mgat4f T A 1: 134,318,626 (GRCm39) V466D probably damaging Het
Mpdz G T 4: 81,205,970 (GRCm39) A1784E probably benign Het
Mpv17l G A 16: 13,764,452 (GRCm39) probably null Het
Mtus1 G A 8: 41,494,545 (GRCm39) S29L possibly damaging Het
Myo15a A T 11: 60,369,313 (GRCm39) H691L possibly damaging Het
Nbea T C 3: 55,625,264 (GRCm39) T2276A probably damaging Het
Npas4 A G 19: 5,036,011 (GRCm39) S718P probably damaging Het
Ntrk2 T A 13: 59,009,170 (GRCm39) N320K possibly damaging Het
Nup214 T A 2: 31,881,384 (GRCm39) I414N possibly damaging Het
Oas2 A G 5: 120,876,428 (GRCm39) F15S probably damaging Het
Or52z15 T C 7: 103,332,285 (GRCm39) I110T probably damaging Het
Or5b118 T C 19: 13,448,981 (GRCm39) Y216H probably damaging Het
Pabpc6 A G 17: 9,888,528 (GRCm39) Y8H probably damaging Het
Pbx1 T A 1: 168,018,964 (GRCm39) N294Y probably damaging Het
Pcyt1a T C 16: 32,285,899 (GRCm39) M190T probably damaging Het
Pogk T C 1: 166,226,991 (GRCm39) I387V possibly damaging Het
Ppp6r2 T C 15: 89,152,741 (GRCm39) L294P probably benign Het
Pramel51 T C 12: 88,144,357 (GRCm39) H152R possibly damaging Het
Ptprn2 T A 12: 116,835,658 (GRCm39) I331K probably benign Het
Ptpro T G 6: 137,370,673 (GRCm39) Y591* probably null Het
Ptprz1 T A 6: 23,001,516 (GRCm39) L1202* probably null Het
Rab37 A G 11: 115,048,789 (GRCm39) T73A probably benign Het
Rad51ap2 T G 12: 11,508,161 (GRCm39) S694R possibly damaging Het
Rb1cc1 T A 1: 6,340,951 (GRCm39) D148E probably damaging Het
Rraga G A 4: 86,494,565 (GRCm39) R137H probably damaging Het
Serpinf2 A G 11: 75,328,329 (GRCm39) V73A probably benign Het
Siglec1 T C 2: 130,923,227 (GRCm39) N506S probably damaging Het
Slc35e4 T C 11: 3,862,602 (GRCm39) T196A possibly damaging Het
St6galnac3 C T 3: 153,117,394 (GRCm39) A110T probably damaging Het
Thsd1 T C 8: 22,733,733 (GRCm39) V260A probably benign Het
Tpbg T A 9: 85,726,538 (GRCm39) V169D possibly damaging Het
Trav16n A G 14: 53,589,042 (GRCm39) E106G probably benign Het
Vmn1r219 T C 13: 23,347,135 (GRCm39) I108T probably benign Het
Vmn2r50 T C 7: 9,771,644 (GRCm39) I686V probably damaging Het
Zdhhc20 C T 14: 58,078,289 (GRCm39) R329K probably benign Het
Zfp64 A G 2: 168,777,129 (GRCm39) probably null Het
Zfp941 C T 7: 140,392,663 (GRCm39) R232H probably benign Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178,743,213 (GRCm39) missense probably damaging 1.00
IGL00425:Kif26b APN 1 178,743,866 (GRCm39) missense probably damaging 0.96
IGL00952:Kif26b APN 1 178,759,770 (GRCm39) missense probably damaging 1.00
IGL01100:Kif26b APN 1 178,744,809 (GRCm39) missense probably benign
IGL01347:Kif26b APN 1 178,698,240 (GRCm39) missense probably damaging 1.00
IGL01543:Kif26b APN 1 178,506,526 (GRCm39) missense probably benign 0.41
IGL01938:Kif26b APN 1 178,743,603 (GRCm39) missense probably damaging 0.99
IGL02100:Kif26b APN 1 178,743,512 (GRCm39) missense probably damaging 0.99
IGL02262:Kif26b APN 1 178,743,633 (GRCm39) missense probably benign 0.05
IGL02576:Kif26b APN 1 178,743,912 (GRCm39) missense probably benign
IGL02673:Kif26b APN 1 178,649,170 (GRCm39) missense probably damaging 1.00
IGL03078:Kif26b APN 1 178,698,291 (GRCm39) missense probably damaging 1.00
IGL03155:Kif26b APN 1 178,701,693 (GRCm39) missense probably damaging 1.00
IGL03157:Kif26b APN 1 178,743,930 (GRCm39) missense probably damaging 1.00
IGL03162:Kif26b APN 1 178,744,497 (GRCm39) missense probably benign
IGL03220:Kif26b APN 1 178,692,434 (GRCm39) missense probably damaging 1.00
IGL03299:Kif26b APN 1 178,649,125 (GRCm39) missense probably benign 0.09
IGL03368:Kif26b APN 1 178,743,773 (GRCm39) missense probably damaging 1.00
IGL03370:Kif26b APN 1 178,742,946 (GRCm39) missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178,745,651 (GRCm39) missense probably damaging 1.00
R0142:Kif26b UTSW 1 178,742,954 (GRCm39) missense probably damaging 1.00
R0621:Kif26b UTSW 1 178,743,218 (GRCm39) missense probably benign 0.02
R0987:Kif26b UTSW 1 178,649,185 (GRCm39) missense probably damaging 1.00
R1107:Kif26b UTSW 1 178,745,238 (GRCm39) missense probably benign 0.03
R1367:Kif26b UTSW 1 178,744,028 (GRCm39) missense probably damaging 1.00
R1386:Kif26b UTSW 1 178,743,209 (GRCm39) missense probably benign
R1619:Kif26b UTSW 1 178,744,043 (GRCm39) missense probably benign 0.00
R1664:Kif26b UTSW 1 178,759,704 (GRCm39) missense probably damaging 1.00
R2240:Kif26b UTSW 1 178,543,488 (GRCm39) missense probably benign 0.00
R2264:Kif26b UTSW 1 178,756,407 (GRCm39) critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178,742,579 (GRCm39) missense probably damaging 0.99
R3023:Kif26b UTSW 1 178,692,433 (GRCm39) missense probably damaging 0.99
R3744:Kif26b UTSW 1 178,506,595 (GRCm39) missense probably benign 0.00
R3831:Kif26b UTSW 1 178,744,181 (GRCm39) frame shift probably null
R3832:Kif26b UTSW 1 178,744,181 (GRCm39) frame shift probably null
R3833:Kif26b UTSW 1 178,744,181 (GRCm39) frame shift probably null
R3843:Kif26b UTSW 1 178,755,742 (GRCm39) missense probably damaging 1.00
R4108:Kif26b UTSW 1 178,744,530 (GRCm39) missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178,742,991 (GRCm39) missense probably damaging 0.98
R4551:Kif26b UTSW 1 178,711,600 (GRCm39) missense probably damaging 1.00
R4552:Kif26b UTSW 1 178,711,600 (GRCm39) missense probably damaging 1.00
R4597:Kif26b UTSW 1 178,744,358 (GRCm39) missense probably damaging 1.00
R4599:Kif26b UTSW 1 178,358,024 (GRCm39) missense unknown
R4610:Kif26b UTSW 1 178,506,920 (GRCm39) missense probably damaging 1.00
R4746:Kif26b UTSW 1 178,701,546 (GRCm39) nonsense probably null
R4873:Kif26b UTSW 1 178,742,892 (GRCm39) missense probably benign 0.38
R4875:Kif26b UTSW 1 178,742,892 (GRCm39) missense probably benign 0.38
R5015:Kif26b UTSW 1 178,755,895 (GRCm39) missense probably damaging 0.99
R5060:Kif26b UTSW 1 178,358,195 (GRCm39) missense unknown
R5301:Kif26b UTSW 1 178,358,233 (GRCm39) missense unknown
R5368:Kif26b UTSW 1 178,743,449 (GRCm39) missense probably damaging 1.00
R5387:Kif26b UTSW 1 178,742,441 (GRCm39) missense probably benign 0.01
R5589:Kif26b UTSW 1 178,743,864 (GRCm39) missense probably benign 0.05
R6150:Kif26b UTSW 1 178,743,111 (GRCm39) missense probably damaging 1.00
R6259:Kif26b UTSW 1 178,744,970 (GRCm39) missense probably damaging 0.97
R6355:Kif26b UTSW 1 178,743,743 (GRCm39) missense probably damaging 1.00
R6408:Kif26b UTSW 1 178,745,133 (GRCm39) missense probably damaging 1.00
R6546:Kif26b UTSW 1 178,755,871 (GRCm39) missense probably damaging 1.00
R6702:Kif26b UTSW 1 178,744,852 (GRCm39) missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178,701,703 (GRCm39) missense probably damaging 1.00
R6953:Kif26b UTSW 1 178,701,637 (GRCm39) missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178,745,219 (GRCm39) missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178,506,611 (GRCm39) missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178,358,306 (GRCm39) missense probably damaging 1.00
R7383:Kif26b UTSW 1 178,358,275 (GRCm39) missense probably damaging 1.00
R7448:Kif26b UTSW 1 178,742,339 (GRCm39) missense probably damaging 1.00
R7506:Kif26b UTSW 1 178,357,064 (GRCm39) start gained probably benign
R7562:Kif26b UTSW 1 178,742,541 (GRCm39) missense probably damaging 1.00
R7583:Kif26b UTSW 1 178,358,010 (GRCm39) nonsense probably null
R7585:Kif26b UTSW 1 178,744,061 (GRCm39) missense probably benign 0.01
R7644:Kif26b UTSW 1 178,506,839 (GRCm39) missense probably benign 0.04
R7759:Kif26b UTSW 1 178,506,509 (GRCm39) missense probably damaging 1.00
R7775:Kif26b UTSW 1 178,692,441 (GRCm39) missense probably benign 0.15
R7954:Kif26b UTSW 1 178,696,944 (GRCm39) missense probably damaging 0.99
R7960:Kif26b UTSW 1 178,506,484 (GRCm39) missense probably damaging 1.00
R8012:Kif26b UTSW 1 178,743,815 (GRCm39) missense probably benign 0.20
R8152:Kif26b UTSW 1 178,506,794 (GRCm39) missense possibly damaging 0.46
R8320:Kif26b UTSW 1 178,711,641 (GRCm39) critical splice donor site probably null
R8360:Kif26b UTSW 1 178,743,938 (GRCm39) missense probably benign 0.18
R8428:Kif26b UTSW 1 178,744,923 (GRCm39) missense probably benign 0.09
R8670:Kif26b UTSW 1 178,741,349 (GRCm39) missense probably damaging 1.00
R8737:Kif26b UTSW 1 178,692,430 (GRCm39) missense probably damaging 0.99
R8788:Kif26b UTSW 1 178,357,090 (GRCm39) start gained probably benign
R8854:Kif26b UTSW 1 178,743,948 (GRCm39) missense possibly damaging 0.93
R8870:Kif26b UTSW 1 178,692,594 (GRCm39) missense probably damaging 1.00
R8963:Kif26b UTSW 1 178,743,714 (GRCm39) missense probably benign 0.00
R9232:Kif26b UTSW 1 178,742,511 (GRCm39) missense probably damaging 1.00
R9297:Kif26b UTSW 1 178,543,374 (GRCm39) nonsense probably null
R9338:Kif26b UTSW 1 178,744,058 (GRCm39) missense probably damaging 1.00
R9572:Kif26b UTSW 1 178,745,042 (GRCm39) missense probably benign
R9580:Kif26b UTSW 1 178,506,643 (GRCm39) nonsense probably null
R9694:Kif26b UTSW 1 178,743,815 (GRCm39) missense probably benign 0.20
X0021:Kif26b UTSW 1 178,755,724 (GRCm39) missense probably damaging 1.00
X0024:Kif26b UTSW 1 178,506,647 (GRCm39) missense probably benign 0.14
X0025:Kif26b UTSW 1 178,742,948 (GRCm39) missense possibly damaging 0.70
X0025:Kif26b UTSW 1 178,742,831 (GRCm39) nonsense probably null
Z1177:Kif26b UTSW 1 178,742,970 (GRCm39) nonsense probably null
Z1177:Kif26b UTSW 1 178,649,115 (GRCm39) nonsense probably null
Z1177:Kif26b UTSW 1 178,649,113 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTTCTGGGGTCCATTTGC -3'
(R):5'- GCTGAAGACATTCCCGTAGC -3'

Sequencing Primer
(F):5'- GGGGTCCATTTGCTTTCATTC -3'
(R):5'- AGACATTCCCGTAGCCAGGC -3'
Posted On 2018-06-06