Incidental Mutation 'R6562:Rel'
ID522483
Institutional Source Beutler Lab
Gene Symbol Rel
Ensembl Gene ENSMUSG00000020275
Gene Namereticuloendotheliosis oncogene
Synonymsc-Rel
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location23736847-23770970 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 23757026 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 59 (G59*)
Ref Sequence ENSEMBL: ENSMUSP00000099928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102864]
Predicted Effect probably null
Transcript: ENSMUST00000102864
AA Change: G59*
SMART Domains Protein: ENSMUSP00000099928
Gene: ENSMUSG00000020275
AA Change: G59*

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 10 178 8.1e-78 PFAM
IPT 185 280 7.64e-24 SMART
low complexity region 512 530 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Rel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Rel APN 11 23757043 missense probably benign 0.31
IGL00819:Rel APN 11 23743029 missense probably benign 0.13
IGL00906:Rel APN 11 23744266 missense probably benign 0.00
IGL01358:Rel APN 11 23761155 missense probably benign 0.06
IGL01820:Rel APN 11 23753218 missense probably benign 0.22
IGL01889:Rel APN 11 23757035 missense probably damaging 0.96
IGL03270:Rel APN 11 23742584 missense probably benign 0.16
Amun-ra UTSW 11 23757026 nonsense probably null
Fleur UTSW 11 unclassified
giza UTSW 11 23757010 missense probably damaging 1.00
Horus UTSW 11 23753215 critical splice donor site probably null
osirus UTSW 11 23742713 missense probably benign 0.00
R0766:Rel UTSW 11 23757010 missense probably damaging 1.00
R0924:Rel UTSW 11 23742439 missense probably benign 0.02
R0930:Rel UTSW 11 23742439 missense probably benign 0.02
R1312:Rel UTSW 11 23757010 missense probably damaging 1.00
R1339:Rel UTSW 11 23745763 missense probably damaging 1.00
R1584:Rel UTSW 11 23745546 missense probably damaging 1.00
R1980:Rel UTSW 11 23742761 missense probably benign
R1981:Rel UTSW 11 23742761 missense probably benign
R1982:Rel UTSW 11 23742761 missense probably benign
R2513:Rel UTSW 11 23745823 missense probably damaging 1.00
R2870:Rel UTSW 11 23761129 missense probably benign
R2870:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R3617:Rel UTSW 11 23745780 missense probably damaging 1.00
R3976:Rel UTSW 11 23742939 missense probably benign 0.07
R4010:Rel UTSW 11 23761138 missense probably benign
R4067:Rel UTSW 11 23753215 critical splice donor site probably null
R5345:Rel UTSW 11 23742462 missense probably benign 0.00
R5866:Rel UTSW 11 23742724 nonsense probably null
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6886:Rel UTSW 11 23744304 missense probably benign 0.03
R7516:Rel UTSW 11 23742785 missense probably benign 0.00
R7522:Rel UTSW 11 23770676 splice site probably null
R7663:Rel UTSW 11 23742713 missense probably benign 0.00
R7873:Rel UTSW 11 23742957 missense probably benign 0.00
R7956:Rel UTSW 11 23742957 missense probably benign 0.00
Z1176:Rel UTSW 11 23745472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTACTAACTATCATGTGCGTACC -3'
(R):5'- CCCAGCTGATATATTCTCTGAAAAC -3'

Sequencing Primer
(F):5'- GAGTTTAATCCTCAGGGTCCACG -3'
(R):5'- TCTCAAGTAAACTGCTGACTATTTG -3'
Posted On2018-06-06