Incidental Mutation 'R6488:Nbea'
ID 522486
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_030595
Essential gene? Essential (E-score: 1.000) question?
Stock # R6488 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 55625195-56183701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55717843 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2276 (T2276A)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029374
AA Change: T2276A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: T2276A

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199535
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
4933406M09Rik T A 1: 134,390,888 V466D probably damaging Het
Abhd15 T C 11: 77,516,022 F275S possibly damaging Het
Adamts7 A G 9: 90,171,482 T27A probably benign Het
Ankar A G 1: 72,681,808 probably null Het
Ap2a2 T C 7: 141,602,307 V183A probably benign Het
Arhgef37 G A 18: 61,518,052 A134V probably benign Het
Col3a1 C A 1: 45,331,534 probably benign Het
Cxcr5 A G 9: 44,513,979 V127A probably damaging Het
Eif4b T A 15: 102,092,987 probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fam83h T C 15: 76,002,053 E1145G possibly damaging Het
Fcgbp A G 7: 28,093,538 D989G probably damaging Het
Fchsd1 T C 18: 37,967,268 probably null Het
Fcnb T C 2: 28,078,289 K219E probably damaging Het
Fndc7 T C 3: 108,870,575 E355G probably damaging Het
Glis3 T C 19: 28,298,853 H746R probably benign Het
Glod4 A G 11: 76,237,785 V74A probably damaging Het
Gm10436 T C 12: 88,177,587 H152R possibly damaging Het
Gpc6 T C 14: 117,964,713 I445T possibly damaging Het
Hdlbp T C 1: 93,428,224 D337G probably damaging Het
Hnf1a T C 5: 114,955,961 T190A probably benign Het
Iqgap1 G C 7: 80,730,326 T1129R probably benign Het
Kcnc3 T C 7: 44,595,182 F299L possibly damaging Het
Kif1bp C A 10: 62,559,658 probably null Het
Kif26b T C 1: 178,529,573 V4A unknown Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap4-1 G T 11: 99,628,077 R36S unknown Het
Lman1l A G 9: 57,620,643 S10P possibly damaging Het
Lrpprc T C 17: 84,751,353 N693S probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mga T A 2: 119,960,907 N2424K probably damaging Het
Mpdz G T 4: 81,287,733 A1784E probably benign Het
Mpv17l G A 16: 13,946,588 probably null Het
Mtus1 G A 8: 41,041,508 S29L possibly damaging Het
Myo15 A T 11: 60,478,487 H691L possibly damaging Het
Npas4 A G 19: 4,985,983 S718P probably damaging Het
Ntrk2 T A 13: 58,861,356 N320K possibly damaging Het
Nup214 T A 2: 31,991,372 I414N possibly damaging Het
Oas2 A G 5: 120,738,363 F15S probably damaging Het
Olfr1474 T C 19: 13,471,617 Y216H probably damaging Het
Olfr625-ps1 T C 7: 103,683,078 I110T probably damaging Het
Pabpc6 A G 17: 9,669,599 Y8H probably damaging Het
Pbx1 T A 1: 168,191,395 N294Y probably damaging Het
Pcyt1a T C 16: 32,467,081 M190T probably damaging Het
Pogk T C 1: 166,399,422 I387V possibly damaging Het
Ppp6r2 T C 15: 89,268,538 L294P probably benign Het
Ptprn2 T A 12: 116,872,038 I331K probably benign Het
Ptpro T G 6: 137,393,675 Y591* probably null Het
Ptprz1 T A 6: 23,001,517 L1202* probably null Het
Rab37 A G 11: 115,157,963 T73A probably benign Het
Rad51ap2 T G 12: 11,458,160 S694R possibly damaging Het
Rb1cc1 T A 1: 6,270,727 D148E probably damaging Het
Rraga G A 4: 86,576,328 R137H probably damaging Het
Serpinf2 A G 11: 75,437,503 V73A probably benign Het
Siglec1 T C 2: 131,081,307 N506S probably damaging Het
Slc35e4 T C 11: 3,912,602 T196A possibly damaging Het
St6galnac3 C T 3: 153,411,757 A110T probably damaging Het
Thsd1 T C 8: 22,243,717 V260A probably benign Het
Tpbg T A 9: 85,844,485 V169D possibly damaging Het
Trav16n A G 14: 53,351,585 E106G probably benign Het
Vmn1r219 T C 13: 23,162,965 I108T probably benign Het
Vmn2r50 T C 7: 10,037,717 I686V probably damaging Het
Zdhhc20 C T 14: 57,840,832 R329K probably benign Het
Zfp64 A G 2: 168,935,209 probably null Het
Zfp941 C T 7: 140,812,750 R232H probably benign Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55628493 missense probably damaging 1.00
IGL00541:Nbea APN 3 55968089 missense probably benign 0.02
IGL00584:Nbea APN 3 56082448 missense probably damaging 0.98
IGL00648:Nbea APN 3 56009260 missense probably damaging 0.98
IGL00785:Nbea APN 3 55955393 missense probably benign
IGL00899:Nbea APN 3 55642845 missense probably benign 0.32
IGL00955:Nbea APN 3 56005472 missense possibly damaging 0.45
IGL01296:Nbea APN 3 56031536 missense probably benign 0.04
IGL01299:Nbea APN 3 55690894 missense probably damaging 1.00
IGL01393:Nbea APN 3 56005308 missense probably benign 0.02
IGL01550:Nbea APN 3 55805248 missense possibly damaging 0.93
IGL02023:Nbea APN 3 55681016 missense probably damaging 1.00
IGL02034:Nbea APN 3 55968156 missense probably damaging 1.00
IGL02061:Nbea APN 3 55717887 missense possibly damaging 0.54
IGL02082:Nbea APN 3 55968167 missense possibly damaging 0.88
IGL02113:Nbea APN 3 55992492 missense probably benign
IGL02188:Nbea APN 3 55983837 missense probably benign 0.00
IGL02319:Nbea APN 3 55985738 missense probably damaging 1.00
IGL02406:Nbea APN 3 56086266 missense probably benign 0.02
IGL02494:Nbea APN 3 55805351 missense probably benign 0.02
IGL02550:Nbea APN 3 56019414 missense probably damaging 0.98
IGL02706:Nbea APN 3 56037278 missense probably damaging 1.00
IGL02718:Nbea APN 3 55632062 nonsense probably null
IGL02822:Nbea APN 3 56019447 missense possibly damaging 0.93
IGL02885:Nbea APN 3 55631986 missense probably benign 0.01
IGL03000:Nbea APN 3 56004627 missense possibly damaging 0.94
IGL03081:Nbea APN 3 56079918 missense probably damaging 1.00
IGL03091:Nbea APN 3 56085304 missense probably damaging 1.00
IGL03368:Nbea APN 3 56079930 missense probably damaging 0.98
Neches UTSW 3 55953034 critical splice donor site probably null
scotland UTSW 3 55626908 missense probably damaging 1.00
Wales UTSW 3 56091119 missense probably damaging 1.00
FR4340:Nbea UTSW 3 56009212 critical splice donor site probably benign
G4846:Nbea UTSW 3 56087497 missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55717869 missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55701527 intron probably benign
R0087:Nbea UTSW 3 56091023 missense possibly damaging 0.92
R0220:Nbea UTSW 3 56005303 missense probably benign 0.30
R0324:Nbea UTSW 3 56057948 critical splice donor site probably null
R0330:Nbea UTSW 3 55642817 missense probably benign 0.27
R0391:Nbea UTSW 3 56037277 missense probably damaging 1.00
R0394:Nbea UTSW 3 56029907 missense probably damaging 1.00
R0419:Nbea UTSW 3 55819294 missense probably benign 0.05
R0503:Nbea UTSW 3 55642836 missense possibly damaging 0.79
R0521:Nbea UTSW 3 56008268 missense probably damaging 1.00
R0595:Nbea UTSW 3 55628496 missense probably benign 0.18
R0894:Nbea UTSW 3 56009340 missense possibly damaging 0.89
R1072:Nbea UTSW 3 56086196 missense possibly damaging 0.94
R1125:Nbea UTSW 3 55857006 nonsense probably null
R1169:Nbea UTSW 3 55968323 missense probably benign 0.00
R1241:Nbea UTSW 3 56058040 missense probably damaging 1.00
R1269:Nbea UTSW 3 56004781 missense probably benign 0.05
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1457:Nbea UTSW 3 56085327 missense probably damaging 1.00
R1482:Nbea UTSW 3 56079993 missense probably damaging 1.00
R1483:Nbea UTSW 3 56002790 missense probably benign 0.25
R1502:Nbea UTSW 3 56004889 missense probably benign 0.03
R1544:Nbea UTSW 3 56058827 missense probably damaging 0.99
R1629:Nbea UTSW 3 56002891 missense possibly damaging 0.52
R1647:Nbea UTSW 3 55630229 missense probably damaging 0.97
R1663:Nbea UTSW 3 55645986 missense possibly damaging 0.95
R1722:Nbea UTSW 3 55665695 missense probably damaging 1.00
R1757:Nbea UTSW 3 55630189 missense possibly damaging 0.83
R1771:Nbea UTSW 3 55934519 missense probably benign 0.00
R1796:Nbea UTSW 3 55643708 missense possibly damaging 0.48
R1844:Nbea UTSW 3 56082436 missense probably damaging 0.97
R1872:Nbea UTSW 3 55642889 missense probably benign 0.12
R1938:Nbea UTSW 3 56085322 missense probably damaging 1.00
R1940:Nbea UTSW 3 55953100 missense possibly damaging 0.78
R2062:Nbea UTSW 3 56086157 splice site probably benign
R2066:Nbea UTSW 3 55968146 missense probably damaging 1.00
R2097:Nbea UTSW 3 55723217 missense probably damaging 0.96
R2181:Nbea UTSW 3 56029939 missense possibly damaging 0.92
R2274:Nbea UTSW 3 55988085 splice site probably null
R2345:Nbea UTSW 3 56085279 missense probably damaging 1.00
R2423:Nbea UTSW 3 56085306 missense probably damaging 1.00
R2434:Nbea UTSW 3 55647460 missense possibly damaging 0.91
R2880:Nbea UTSW 3 55647358 missense probably benign 0.04
R2881:Nbea UTSW 3 55647358 missense probably benign 0.04
R2940:Nbea UTSW 3 55934624 missense probably benign 0.24
R3500:Nbea UTSW 3 55681010 missense possibly damaging 0.88
R3765:Nbea UTSW 3 56005549 missense probably damaging 1.00
R3790:Nbea UTSW 3 56005029 missense probably benign
R3808:Nbea UTSW 3 55717848 missense probably benign 0.02
R3845:Nbea UTSW 3 56086292 splice site probably benign
R4182:Nbea UTSW 3 56008427 missense probably damaging 0.99
R4385:Nbea UTSW 3 56000638 missense possibly damaging 0.77
R4419:Nbea UTSW 3 56009600 missense probably damaging 1.00
R4426:Nbea UTSW 3 56082379 missense probably damaging 0.98
R4451:Nbea UTSW 3 55992332 critical splice donor site probably null
R4456:Nbea UTSW 3 55643784 missense probably benign 0.00
R4604:Nbea UTSW 3 55723648 missense probably benign 0.18
R4687:Nbea UTSW 3 56058065 missense probably damaging 1.00
R4758:Nbea UTSW 3 56005403 missense probably benign
R4840:Nbea UTSW 3 55710670 missense probably benign 0.37
R4888:Nbea UTSW 3 56005355 missense possibly damaging 0.61
R4954:Nbea UTSW 3 56035958 missense probably damaging 1.00
R4972:Nbea UTSW 3 56085246 missense probably damaging 0.99
R4980:Nbea UTSW 3 55647351 splice site probably null
R4980:Nbea UTSW 3 55953045 missense probably benign 0.00
R5104:Nbea UTSW 3 56079927 missense probably damaging 1.00
R5139:Nbea UTSW 3 55626963 missense possibly damaging 0.90
R5166:Nbea UTSW 3 56019453 missense probably damaging 1.00
R5347:Nbea UTSW 3 56040876 missense probably damaging 1.00
R5350:Nbea UTSW 3 56019424 missense probably damaging 1.00
R5418:Nbea UTSW 3 55645989 missense possibly damaging 0.86
R5586:Nbea UTSW 3 55631971 missense probably benign 0.08
R5627:Nbea UTSW 3 55992345 missense probably damaging 1.00
R5683:Nbea UTSW 3 55628586 missense possibly damaging 0.53
R5765:Nbea UTSW 3 56005298 missense probably benign 0.15
R5853:Nbea UTSW 3 55992401 missense probably damaging 1.00
R5858:Nbea UTSW 3 55953034 critical splice donor site probably null
R5955:Nbea UTSW 3 55680983 missense probably benign 0.00
R5976:Nbea UTSW 3 55853847 missense probably benign 0.30
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6043:Nbea UTSW 3 55786475 missense probably benign 0.32
R6122:Nbea UTSW 3 56029896 missense probably damaging 1.00
R6218:Nbea UTSW 3 55628484 missense probably damaging 0.97
R6331:Nbea UTSW 3 56000616 missense possibly damaging 0.94
R6334:Nbea UTSW 3 56037149 missense probably damaging 1.00
R6393:Nbea UTSW 3 56091119 missense probably damaging 1.00
R6411:Nbea UTSW 3 55805357 missense probably benign 0.01
R6457:Nbea UTSW 3 56000569 missense probably damaging 1.00
R6476:Nbea UTSW 3 56004806 missense probably benign 0.00
R6700:Nbea UTSW 3 56082448 missense possibly damaging 0.89
R6702:Nbea UTSW 3 56005502 missense probably benign 0.06
R6752:Nbea UTSW 3 55968309 missense probably benign 0.02
R6752:Nbea UTSW 3 56037219 missense probably benign
R6804:Nbea UTSW 3 56087453 missense probably benign 0.37
R6901:Nbea UTSW 3 56019415 missense probably damaging 1.00
R6933:Nbea UTSW 3 55723610 missense possibly damaging 0.63
R7124:Nbea UTSW 3 55992444 missense probably damaging 1.00
R7211:Nbea UTSW 3 56004901 missense probably benign 0.05
R7308:Nbea UTSW 3 56091031 missense probably damaging 1.00
R7405:Nbea UTSW 3 55805266 missense possibly damaging 0.94
R7669:Nbea UTSW 3 55717779 missense probably damaging 1.00
R7762:Nbea UTSW 3 55649705 missense probably damaging 1.00
R7833:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7885:Nbea UTSW 3 55665689 missense probably damaging 0.97
R7935:Nbea UTSW 3 56058665 missense probably damaging 1.00
R8050:Nbea UTSW 3 55987981 missense probably damaging 0.99
R8108:Nbea UTSW 3 55819315 missense probably benign 0.11
R8290:Nbea UTSW 3 56058635 nonsense probably null
R8314:Nbea UTSW 3 56009251 missense probably damaging 0.99
R8321:Nbea UTSW 3 56183097 missense possibly damaging 0.86
R8376:Nbea UTSW 3 55643655 missense possibly damaging 0.79
R8410:Nbea UTSW 3 56037263 missense probably damaging 1.00
R8556:Nbea UTSW 3 55647386 missense probably benign 0.25
R8753:Nbea UTSW 3 55626908 missense probably damaging 1.00
R8844:Nbea UTSW 3 56090994 missense probably damaging 0.97
R8884:Nbea UTSW 3 55805299 missense probably benign 0.00
R8886:Nbea UTSW 3 56058727 missense probably damaging 1.00
R8890:Nbea UTSW 3 56019363 splice site probably benign
R9004:Nbea UTSW 3 56002938 missense probably benign 0.01
R9022:Nbea UTSW 3 55643689 missense possibly damaging 0.79
R9080:Nbea UTSW 3 56005095 nonsense probably null
R9087:Nbea UTSW 3 55642736 critical splice donor site probably null
R9104:Nbea UTSW 3 55955388 missense probably benign
R9165:Nbea UTSW 3 56004868 missense probably benign 0.15
R9219:Nbea UTSW 3 56090972 frame shift probably null
R9221:Nbea UTSW 3 56090972 frame shift probably null
R9222:Nbea UTSW 3 56090972 frame shift probably null
R9260:Nbea UTSW 3 55983812 missense possibly damaging 0.50
R9263:Nbea UTSW 3 56090972 frame shift probably null
R9265:Nbea UTSW 3 56090972 frame shift probably null
R9294:Nbea UTSW 3 56091092 missense probably benign 0.00
R9360:Nbea UTSW 3 56035898 missense possibly damaging 0.96
R9387:Nbea UTSW 3 55991039 missense probably benign 0.12
R9428:Nbea UTSW 3 56090972 frame shift probably null
R9435:Nbea UTSW 3 56035888 missense possibly damaging 0.63
R9507:Nbea UTSW 3 55665590 missense probably damaging 1.00
R9514:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9516:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9674:Nbea UTSW 3 56058762 missense probably damaging 1.00
R9688:Nbea UTSW 3 55649744 missense probably benign 0.42
R9709:Nbea UTSW 3 55786458 nonsense probably null
RF051:Nbea UTSW 3 56009212 critical splice donor site probably benign
X0018:Nbea UTSW 3 56036048 missense probably benign 0.39
Z1088:Nbea UTSW 3 55723163 missense probably benign 0.34
Z1177:Nbea UTSW 3 56031550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGACAAGGGGAAACATC -3'
(R):5'- TTTTATAATCCACCCAAGAAGGCC -3'

Sequencing Primer
(F):5'- ACCTTGGTATCAGCTGCACAG -3'
(R):5'- CAAGCCACAAATTACTGACTGATGTC -3'
Posted On 2018-06-06