Incidental Mutation 'R6562:Abt1'
ID522491
Institutional Source Beutler Lab
Gene Symbol Abt1
Ensembl Gene ENSMUSG00000036376
Gene Nameactivator of basal transcription 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23418361-23423866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23423588 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 82 (E82A)
Ref Sequence ENSEMBL: ENSMUSP00000045888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041782]
Predicted Effect probably damaging
Transcript: ENSMUST00000041782
AA Change: E82A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045888
Gene: ENSMUSG00000036376
AA Change: E82A

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
low complexity region 36 44 N/A INTRINSIC
Blast:RRM 49 141 9e-34 BLAST
SCOP:d1fxla1 50 137 4e-3 SMART
coiled coil region 166 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153753
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Basal transcription of genes by RNA polymerase II requires the interaction of TATA-binding protein (TBP) with the core region of class II promoters. Studies in mouse suggest that the protein encoded by this gene likely activates basal transcription from class II promoters by interaction with TBP and the class II promoter DNA. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Abt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Abt1 APN 13 23423768 missense unknown
IGL01917:Abt1 APN 13 23423789 missense unknown
FR4548:Abt1 UTSW 13 23423711 small deletion probably benign
FR4976:Abt1 UTSW 13 23423711 small deletion probably benign
PIT4486001:Abt1 UTSW 13 23423681 missense possibly damaging 0.87
R0029:Abt1 UTSW 13 23422508 missense possibly damaging 0.85
R2171:Abt1 UTSW 13 23422217 missense probably damaging 1.00
R4082:Abt1 UTSW 13 23422146 missense probably benign 0.00
R5125:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5178:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5204:Abt1 UTSW 13 23422668 missense probably damaging 1.00
R5947:Abt1 UTSW 13 23422055 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATCGTGGGTCTCTTTCAGGC -3'
(R):5'- TCTTGCCATGGTGAAAGCG -3'

Sequencing Primer
(F):5'- GGTCTCTTTCAGGCCTTATTAAAC -3'
(R):5'- TTGGTGGAGCAGCAAAAGGC -3'
Posted On2018-06-06