Incidental Mutation 'R6562:Lrmda'
ID522497
Institutional Source Beutler Lab
Gene Symbol Lrmda
Ensembl Gene ENSMUSG00000063458
Gene Nameleucine rich melanocyte differentiation associated
SynonymsOca7, 1700112E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location22019712-23056085 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 22598186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075639] [ENSMUST00000159777] [ENSMUST00000161249] [ENSMUST00000162540] [ENSMUST00000226003]
Predicted Effect probably benign
Transcript: ENSMUST00000075639
SMART Domains Protein: ENSMUSP00000075065
Gene: ENSMUSG00000063458

DomainStartEndE-ValueType
low complexity region 55 82 N/A INTRINSIC
LRRcap 129 147 6.28e-1 SMART
low complexity region 167 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159777
SMART Domains Protein: ENSMUSP00000125751
Gene: ENSMUSG00000063458

DomainStartEndE-ValueType
SCOP:d1h6ua2 34 109 1e-8 SMART
LRRcap 129 147 6.28e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161249
SMART Domains Protein: ENSMUSP00000124221
Gene: ENSMUSG00000063458

DomainStartEndE-ValueType
low complexity region 78 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162337
Predicted Effect probably benign
Transcript: ENSMUST00000162540
SMART Domains Protein: ENSMUSP00000124436
Gene: ENSMUSG00000063458

DomainStartEndE-ValueType
low complexity region 55 82 N/A INTRINSIC
LRRcap 129 147 6.28e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000226003
AA Change: V28A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich repeat protein. The encoded protein is thought to play a role in melanocyte differentiation. Mutations in this gene have been associated with autosomal recessive oculocutaneous albinism 7 (OCA7). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Lrmda
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Lrmda APN 14 22596517 missense possibly damaging 0.49
IGL01982:Lrmda APN 14 22584482 missense probably damaging 1.00
IGL02792:Lrmda APN 14 22019910 critical splice donor site probably null
IGL02826:Lrmda APN 14 22828737 missense probably damaging 1.00
Bowie UTSW 14 22027235 nonsense probably null
Stardust UTSW 14 22027306 missense probably damaging 1.00
R1921:Lrmda UTSW 14 22577870 missense probably damaging 1.00
R3720:Lrmda UTSW 14 22027331 splice site probably benign
R3722:Lrmda UTSW 14 22027331 splice site probably benign
R4242:Lrmda UTSW 14 22027235 nonsense probably null
R5393:Lrmda UTSW 14 22027306 missense probably damaging 1.00
R6749:Lrmda UTSW 14 22027276 missense probably benign 0.02
R7155:Lrmda UTSW 14 22584540 missense probably damaging 1.00
R7560:Lrmda UTSW 14 22828702 missense probably benign 0.15
R7580:Lrmda UTSW 14 22019857 start gained probably benign
R7885:Lrmda UTSW 14 22598320 missense unknown
R7968:Lrmda UTSW 14 22598320 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAATGCACATGACTGCCTTTAG -3'
(R):5'- TCTATGCGTACAGGGCTCAG -3'

Sequencing Primer
(F):5'- ACATGACTGCCTTTAGTTATTCCAG -3'
(R):5'- GAGCCAGGCACATACAGAGTAC -3'
Posted On2018-06-06