Mutagenetix > Incidental Mutations

Incidental Mutation 'R6563:Irs1'

522513

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.544) question?

Stock #

R6563 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82288407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 696 (N696I)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069799
AA Change: N696I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: N696I

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.2989

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Cyp4a14	T	A	4: 115,492,086	H259L	probably benign	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Diexf	C	A	1: 193,118,390	R374L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
L3mbtl3	A	C	10: 26,302,863		probably null	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Ltbp4	A	T	7: 27,309,063	N1273K	probably damaging	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Terf2ip	G	T	8: 112,018,202	V384F	probably damaging	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tspoap1	A	G	11: 87,777,159	E1263G	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,501	A68V	probably benign	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- GCTTAAAGGACCTTGGCAATGAG -3'
(R):5'- GAGCCCCAAGAGTGTATCTG -3'

Sequencing Primer
(F):5'- TAAGAGAGGACCGGCTTGTGC -3'
(R):5'- AGAGTGTATCTGCCCCACAGC -3'

Posted On

2018-06-06