Mutagenetix > Incidental Mutation

Incidental Mutation 'R6563:Diexf'

522517

Institutional Source

Beutler Lab

Gene Symbol

Diexf

Ensembl Gene

ENSMUSG00000016181

Gene Name

digestive organ expansion factor homolog (zebrafish)

Synonyms

AA408296

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R6563 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

193091104-193130272 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 193118390 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 374 (R374L)

Ref Sequence

ENSEMBL: ENSMUSP00000141676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085555] [ENSMUST00000193460] [ENSMUST00000195291] [ENSMUST00000195848]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000085555
AA Change: R374L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181
AA Change: R374L

Domain	Start	End	E-Value	Type
low complexity region	51	70	N/A	INTRINSIC
coiled coil region	72	113	N/A	INTRINSIC
low complexity region	123	139	N/A	INTRINSIC
low complexity region	217	224	N/A	INTRINSIC
Pfam:UTP25	288	763	6.1e-200	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191928

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193070

Predicted Effect

probably benign
Transcript: ENSMUST00000193460

SMART Domains

Protein: ENSMUSP00000142059
Gene: ENSMUSG00000016181

Domain	Start	End	E-Value	Type
Pfam:DUF1253	1	205	6.8e-78	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194335

Predicted Effect

probably benign
Transcript: ENSMUST00000194412

Predicted Effect

probably damaging
Transcript: ENSMUST00000195291
AA Change: R374L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141676
Gene: ENSMUSG00000016181
AA Change: R374L

Domain	Start	End	E-Value	Type
low complexity region	51	70	N/A	INTRINSIC
coiled coil region	72	113	N/A	INTRINSIC
low complexity region	123	139	N/A	INTRINSIC
low complexity region	217	224	N/A	INTRINSIC
Pfam:DUF1253	325	634	6.9e-100	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195848

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Cyp4a14	T	A	4: 115,492,086	H259L	probably benign	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Irs1	T	A	1: 82,288,407	N696I	probably damaging	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
L3mbtl3	A	C	10: 26,302,863		probably null	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Ltbp4	A	T	7: 27,309,063	N1273K	probably damaging	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Terf2ip	G	T	8: 112,018,202	V384F	probably damaging	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tspoap1	A	G	11: 87,777,159	E1263G	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,501	A68V	probably benign	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in Diexf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Diexf	APN	1	193115001	missense	probably damaging	1.00
IGL01700:Diexf	APN	1	193118265	missense	probably damaging	1.00
IGL02076:Diexf	APN	1	193130059	missense	probably damaging	1.00
IGL02121:Diexf	APN	1	193118278	missense	probably benign	0.05
IGL02666:Diexf	APN	1	193107596	nonsense	probably null
IGL02997:Diexf	APN	1	193120584	missense	probably benign	0.34
3-1:Diexf	UTSW	1	193118280	missense	probably benign	0.07
R0099:Diexf	UTSW	1	193128470	missense	probably damaging	1.00
R0395:Diexf	UTSW	1	193123676	missense	possibly damaging	0.69
R0502:Diexf	UTSW	1	193114828	splice site	probably benign
R0973:Diexf	UTSW	1	193114703	missense	probably damaging	0.98
R0973:Diexf	UTSW	1	193114703	missense	probably damaging	0.98
R0974:Diexf	UTSW	1	193114703	missense	probably damaging	0.98
R1815:Diexf	UTSW	1	193118283	missense	probably benign	0.26
R1930:Diexf	UTSW	1	193118309	missense	probably damaging	1.00
R1931:Diexf	UTSW	1	193118309	missense	probably damaging	1.00
R1937:Diexf	UTSW	1	193122093	missense	probably damaging	1.00
R2847:Diexf	UTSW	1	193128451	missense	probably benign	0.41
R2848:Diexf	UTSW	1	193128451	missense	probably benign	0.41
R3412:Diexf	UTSW	1	193128502	missense	possibly damaging	0.93
R3414:Diexf	UTSW	1	193128502	missense	possibly damaging	0.93
R4471:Diexf	UTSW	1	193130137	missense	possibly damaging	0.68
R4627:Diexf	UTSW	1	193107695	missense	probably benign	0.00
R4644:Diexf	UTSW	1	193128480	missense	probably damaging	1.00
R4761:Diexf	UTSW	1	193113922	missense	probably damaging	1.00
R4791:Diexf	UTSW	1	193128267	missense	probably benign
R4793:Diexf	UTSW	1	193113808	missense	probably null	0.56
R4858:Diexf	UTSW	1	193113764	missense	probably damaging	1.00
R4944:Diexf	UTSW	1	193114954	missense	probably damaging	1.00
R5162:Diexf	UTSW	1	193113781	missense	probably damaging	1.00
R5347:Diexf	UTSW	1	193128379	missense	probably benign
R5837:Diexf	UTSW	1	193118393	missense	probably damaging	1.00
R6113:Diexf	UTSW	1	193129502	missense	probably null	0.01
R6455:Diexf	UTSW	1	193128376	missense	probably benign	0.07
R6636:Diexf	UTSW	1	193113767	missense	probably damaging	1.00
R7018:Diexf	UTSW	1	193114855	missense	probably benign	0.06
R7037:Diexf	UTSW	1	193120723	splice site	probably null
R8027:Diexf	UTSW	1	193118222	missense	probably benign
R8042:Diexf	UTSW	1	193114672	missense
R8092:Diexf	UTSW	1	193120363	missense	probably benign	0.00
R8243:Diexf	UTSW	1	193114629	missense	probably benign
R8691:Diexf	UTSW	1	193113802	missense	probably benign	0.41
R9485:Diexf	UTSW	1	193130233	unclassified	probably benign
RF021:Diexf	UTSW	1	193120666	missense	probably benign
X0050:Diexf	UTSW	1	193123732	missense	probably benign	0.23
Z1177:Diexf	UTSW	1	193114675	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCATCAATATTGCCCACGAAC -3'
(R):5'- GAGCTTCCACGGCTACTATG -3'

Sequencing Primer
(F):5'- GAACACAGCTTCATAATCCTCAGG -3'
(R):5'- ACGGCTACTATGGGCATTCC -3'

Posted On

2018-06-06