Incidental Mutation 'R6563:Dnm1'
ID522519
Institutional Source Beutler Lab
Gene Symbol Dnm1
Ensembl Gene ENSMUSG00000026825
Gene Namedynamin 1
Synonymsdynamin 1, Ftfl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6563 (G1)
Quality Score196.009
Status Not validated
Chromosome2
Chromosomal Location32308471-32353338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32312726 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 759 (D759V)
Ref Sequence ENSEMBL: ENSMUSP00000143955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000081670] [ENSMUST00000091089] [ENSMUST00000100194] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000113377] [ENSMUST00000129156] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201440] [ENSMUST00000201494] [ENSMUST00000202578]
Predicted Effect probably damaging
Transcript: ENSMUST00000078352
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825
AA Change: D759V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081670
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091089
AA Change: D755V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825
AA Change: D755V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100194
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113350
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825
AA Change: D759V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113352
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825
AA Change: D759V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113365
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825
AA Change: D759V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113377
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126276
Predicted Effect probably damaging
Transcript: ENSMUST00000129156
AA Change: D228V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118914
Gene: ENSMUSG00000026825
AA Change: D228V

DomainStartEndE-ValueType
PH 1 96 2.75e-2 SMART
GED 123 214 9.51e-32 SMART
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 258 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139291
AA Change: D56V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115523
Gene: ENSMUSG00000026825
AA Change: D56V

DomainStartEndE-ValueType
Pfam:GED 1 43 3.3e-7 PFAM
low complexity region 45 59 N/A INTRINSIC
low complexity region 81 114 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139624
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825
AA Change: D759V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141633
Predicted Effect probably damaging
Transcript: ENSMUST00000201433
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825
AA Change: D759V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201440
AA Change: D55V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144309
Gene: ENSMUSG00000026825
AA Change: D55V

DomainStartEndE-ValueType
Pfam:GED 1 41 5.9e-7 PFAM
low complexity region 43 57 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201494
AA Change: D730V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825
AA Change: D730V

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202578
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825
AA Change: D759V

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155269
AA Change: D66V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116054
Gene: ENSMUSG00000026825
AA Change: D66V

DomainStartEndE-ValueType
GED 1 53 1.63e-1 SMART
low complexity region 55 69 N/A INTRINSIC
low complexity region 91 124 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145885
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein is a GTPase which is required for membrane recycling, including vesicle endocytosis in neurons. It may also be involved in cellular fission via association with microtubules and actin filaments. Mutations in this gene have been shown to cause seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice display reduced postnatal viability. Null mutation of this gene results in abnormal synaptic vesicle morphology, and recycling during neuronal activity. Other alleles are associated with seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Dnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Dnm1 APN 2 32323450 missense probably benign 0.18
IGL02338:Dnm1 APN 2 32312771 missense probably damaging 1.00
IGL02555:Dnm1 APN 2 32328038 missense probably damaging 1.00
IGL02563:Dnm1 APN 2 32315919 splice site probably null
IGL03006:Dnm1 APN 2 32353121 missense possibly damaging 0.84
IGL03013:Dnm1 APN 2 32336284 missense probably benign 0.13
IGL03347:Dnm1 APN 2 32353187 missense probably benign 0.32
R0180:Dnm1 UTSW 2 32327993 missense probably damaging 0.99
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0387:Dnm1 UTSW 2 32320581 missense possibly damaging 0.90
R0608:Dnm1 UTSW 2 32335824 missense possibly damaging 0.89
R1230:Dnm1 UTSW 2 32315909 missense probably damaging 1.00
R1474:Dnm1 UTSW 2 32320584 missense probably benign 0.31
R1703:Dnm1 UTSW 2 32323451 missense probably benign 0.01
R1881:Dnm1 UTSW 2 32323730 missense probably damaging 1.00
R2155:Dnm1 UTSW 2 32314937 missense probably damaging 0.96
R4405:Dnm1 UTSW 2 32335972 missense probably damaging 1.00
R4592:Dnm1 UTSW 2 32336011 missense probably damaging 0.99
R5357:Dnm1 UTSW 2 32336241 missense probably null 0.17
R5926:Dnm1 UTSW 2 32315804 missense probably benign 0.00
R6135:Dnm1 UTSW 2 32333063 splice site probably null
R6463:Dnm1 UTSW 2 32309591 utr 3 prime probably benign
R6626:Dnm1 UTSW 2 32340880 missense probably damaging 1.00
R6707:Dnm1 UTSW 2 32336241 missense probably null 0.17
R6790:Dnm1 UTSW 2 32333067 missense probably damaging 1.00
R6803:Dnm1 UTSW 2 32312754 missense probably damaging 1.00
R7156:Dnm1 UTSW 2 32340467 missense probably damaging 1.00
R7313:Dnm1 UTSW 2 32336009 missense probably damaging 1.00
R7809:Dnm1 UTSW 2 32353079 missense probably damaging 1.00
R7919:Dnm1 UTSW 2 32339978 missense probably damaging 1.00
R8481:Dnm1 UTSW 2 32340478 missense probably benign 0.01
R8486:Dnm1 UTSW 2 32334727 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATAAGCCCCGCCCTCTTCTAAG -3'
(R):5'- CAGTTCTGTACCCAGATCCAG -3'

Sequencing Primer
(F):5'- TAAGCTCCTCCCCTCGC -3'
(R):5'- CTGTGCACAGACCAAGGAGTTTATC -3'
Posted On2018-06-06