Incidental Mutation 'R6563:Mvb12b'
ID522521
Institutional Source Beutler Lab
Gene Symbol Mvb12b
Ensembl Gene ENSMUSG00000038740
Gene Namemultivesicular body subunit 12B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location33729953-33887946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33825116 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 167 (H167Q)
Ref Sequence ENSEMBL: ENSMUSP00000115744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041555] [ENSMUST00000148660]
Predicted Effect probably benign
Transcript: ENSMUST00000041555
AA Change: H196Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048901
Gene: ENSMUSG00000038740
AA Change: H196Q

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DUF2464 46 297 1.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148660
AA Change: H167Q

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115744
Gene: ENSMUSG00000038740
AA Change: H167Q

DomainStartEndE-ValueType
Pfam:DUF2464 17 189 1.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192765
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the ESCRT-I complex, a heterotetramer, which mediates the sorting of ubiquitinated cargo protein from the plasma membrane to the endosomal vesicle. ESCRT-I complex plays an essential role in HIV budding and endosomal protein sorting. Depletion and overexpression of this and related protein (MVB12A) inhibit HIV-1 infectivity and induce unusual viral assembly defects, indicating a role for MVB12 subunits in regulating ESCRT-mediated virus budding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Mvb12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Mvb12b APN 2 33827788 missense probably damaging 1.00
IGL02493:Mvb12b APN 2 33840209 missense probably benign 0.05
R1845:Mvb12b UTSW 2 33840157 critical splice donor site probably null
R2225:Mvb12b UTSW 2 33840199 missense possibly damaging 0.88
R4545:Mvb12b UTSW 2 33827700 missense possibly damaging 0.63
R5631:Mvb12b UTSW 2 33827703 missense probably damaging 1.00
R5733:Mvb12b UTSW 2 33827716 missense probably benign 0.02
R6043:Mvb12b UTSW 2 33874390 missense probably damaging 1.00
R6386:Mvb12b UTSW 2 33827742 missense probably damaging 1.00
Z1176:Mvb12b UTSW 2 33874370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCAAGTTTAGACTTCTG -3'
(R):5'- ACTCCTGCTAGGCTCTAGTG -3'

Sequencing Primer
(F):5'- GTTTAGACTTCTGCAAATTTTCAGC -3'
(R):5'- TGCTAGGCTCTAGTGCAGCAC -3'
Posted On2018-06-06