Incidental Mutation 'R6563:Arhgap11a'
ID522523
Institutional Source Beutler Lab
Gene Symbol Arhgap11a
Ensembl Gene ENSMUSG00000041219
Gene NameRho GTPase activating protein 11A
SynonymsGAP (1-12), 6530401L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location113831492-113848661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113833902 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 679 (C679S)
Ref Sequence ENSEMBL: ENSMUSP00000106574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024005] [ENSMUST00000102545] [ENSMUST00000110947] [ENSMUST00000110948] [ENSMUST00000110949]
Predicted Effect probably benign
Transcript: ENSMUST00000024005
SMART Domains Protein: ENSMUSP00000024005
Gene: ENSMUSG00000023236

DomainStartEndE-ValueType
Pfam:Secretogranin_V 23 160 4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102545
AA Change: C679S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099604
Gene: ENSMUSG00000041219
AA Change: C679S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110947
SMART Domains Protein: ENSMUSP00000106572
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 7e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110948
SMART Domains Protein: ENSMUSP00000106573
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 6e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110949
AA Change: C679S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106574
Gene: ENSMUSG00000041219
AA Change: C679S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase activating protein family. In response to DNA damage, the encoded protein interacts with the p53 tumor suppressor protein and stimulates its tetramerization, which results in cell-cycle arrest and apoptosis. A chromosomal deletion that includes this gene is one cause of Prader-Willi syndrome, and an intronic variant of this gene may be associated with sleep duration in children. This gene is highly expressed in colon cancers and in a human basal-like breast cancer cell line. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Arhgap11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Arhgap11a APN 2 113834256 missense probably benign 0.00
IGL00337:Arhgap11a APN 2 113841942 missense probably damaging 0.96
IGL00532:Arhgap11a APN 2 113834066 missense probably benign
IGL00869:Arhgap11a APN 2 113834826 missense probably damaging 0.99
IGL01123:Arhgap11a APN 2 113834773 splice site probably benign
IGL01353:Arhgap11a APN 2 113833524 missense probably damaging 1.00
IGL01725:Arhgap11a APN 2 113837552 missense probably damaging 0.98
IGL01911:Arhgap11a APN 2 113840732 missense probably damaging 1.00
IGL02077:Arhgap11a APN 2 113837471 missense possibly damaging 0.94
IGL02532:Arhgap11a APN 2 113833676 nonsense probably null
IGL02553:Arhgap11a APN 2 113837561 splice site probably benign
IGL02738:Arhgap11a APN 2 113832975 makesense probably null
IGL02945:Arhgap11a APN 2 113837473 missense possibly damaging 0.83
R0480:Arhgap11a UTSW 2 113839818 missense probably benign 0.03
R0515:Arhgap11a UTSW 2 113837471 missense possibly damaging 0.48
R0625:Arhgap11a UTSW 2 113841711 missense probably benign 0.01
R0898:Arhgap11a UTSW 2 113836876 missense probably benign 0.01
R1248:Arhgap11a UTSW 2 113834102 missense possibly damaging 0.63
R1395:Arhgap11a UTSW 2 113833122 missense probably benign 0.00
R1669:Arhgap11a UTSW 2 113841912 missense possibly damaging 0.92
R2915:Arhgap11a UTSW 2 113833508 missense probably damaging 1.00
R3941:Arhgap11a UTSW 2 113836897 missense probably damaging 1.00
R4194:Arhgap11a UTSW 2 113841994 missense probably benign 0.02
R4508:Arhgap11a UTSW 2 113842042 missense probably damaging 1.00
R4617:Arhgap11a UTSW 2 113834078 missense probably benign 0.01
R4839:Arhgap11a UTSW 2 113842029 missense probably damaging 1.00
R4842:Arhgap11a UTSW 2 113839762 missense probably damaging 0.98
R5507:Arhgap11a UTSW 2 113841678 missense probably benign
R5538:Arhgap11a UTSW 2 113837530 missense probably benign
R5660:Arhgap11a UTSW 2 113841910 missense possibly damaging 0.80
R5712:Arhgap11a UTSW 2 113845301 missense probably benign 0.09
R5849:Arhgap11a UTSW 2 113834847 missense probably null 0.01
R5856:Arhgap11a UTSW 2 113833771 missense possibly damaging 0.63
R6101:Arhgap11a UTSW 2 113834874 nonsense probably null
R6119:Arhgap11a UTSW 2 113834350 missense probably benign
R6338:Arhgap11a UTSW 2 113833725 missense probably benign 0.37
R6919:Arhgap11a UTSW 2 113839709 missense possibly damaging 0.94
R7798:Arhgap11a UTSW 2 113843335 missense probably damaging 0.98
R7819:Arhgap11a UTSW 2 113834918 critical splice acceptor site probably null
R8208:Arhgap11a UTSW 2 113842939 missense probably benign 0.10
X0065:Arhgap11a UTSW 2 113834231 missense probably benign 0.41
Z1088:Arhgap11a UTSW 2 113842894 missense probably damaging 1.00
Z1176:Arhgap11a UTSW 2 113833758 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TTTCGAAAGGACCGCCACAC -3'
(R):5'- AGCAGTCATCAGTAACAAATACGG -3'

Sequencing Primer
(F):5'- GTGCTCTCATCTTCTCCGGGAG -3'
(R):5'- TCATCAGTAACAAATACGGGGGAAG -3'
Posted On2018-06-06