Incidental Mutation 'R6563:Fam83c'
ID522525
Institutional Source Beutler Lab
Gene Symbol Fam83c
Ensembl Gene ENSMUSG00000074647
Gene Namefamily with sequence similarity 83, member C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155827548-155834854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155830952 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 295 (V295A)
Ref Sequence ENSEMBL: ENSMUSP00000029143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029142] [ENSMUST00000029143] [ENSMUST00000109638] [ENSMUST00000129830] [ENSMUST00000134278] [ENSMUST00000154841]
Predicted Effect probably benign
Transcript: ENSMUST00000029142
SMART Domains Protein: ENSMUSP00000029142
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 204 2.72e-136 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000029143
AA Change: V295A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029143
Gene: ENSMUSG00000074647
AA Change: V295A

DomainStartEndE-ValueType
Pfam:DUF1669 61 337 3.1e-107 PFAM
low complexity region 347 357 N/A INTRINSIC
low complexity region 368 385 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
low complexity region 474 484 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109638
SMART Domains Protein: ENSMUSP00000105266
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 70 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129830
SMART Domains Protein: ENSMUSP00000120206
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 68 4.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134278
SMART Domains Protein: ENSMUSP00000123190
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 1 58 5.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141926
Predicted Effect probably benign
Transcript: ENSMUST00000154841
SMART Domains Protein: ENSMUSP00000115715
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 45 7.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Fam83c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam83c APN 2 155834442 missense probably damaging 1.00
IGL01470:Fam83c APN 2 155834808 missense possibly damaging 0.73
IGL02695:Fam83c APN 2 155831515 missense probably benign 0.04
R0255:Fam83c UTSW 2 155829752 missense probably benign 0.00
R0321:Fam83c UTSW 2 155829700 missense probably benign
R0449:Fam83c UTSW 2 155830295 missense probably benign 0.00
R1596:Fam83c UTSW 2 155831062 critical splice acceptor site probably null
R1635:Fam83c UTSW 2 155830051 missense possibly damaging 0.95
R2006:Fam83c UTSW 2 155830303 missense probably benign 0.04
R2165:Fam83c UTSW 2 155831524 missense possibly damaging 0.94
R3840:Fam83c UTSW 2 155834748 missense probably benign
R3841:Fam83c UTSW 2 155834748 missense probably benign
R4693:Fam83c UTSW 2 155830234 missense probably damaging 1.00
R5660:Fam83c UTSW 2 155829589 missense probably benign 0.08
R6364:Fam83c UTSW 2 155834523 missense probably damaging 1.00
R6976:Fam83c UTSW 2 155830237 missense possibly damaging 0.63
R7124:Fam83c UTSW 2 155829571 missense probably benign 0.00
R7643:Fam83c UTSW 2 155831004 missense possibly damaging 0.93
R8088:Fam83c UTSW 2 155831639 missense probably damaging 0.98
R8113:Fam83c UTSW 2 155834820 missense probably benign 0.33
R8212:Fam83c UTSW 2 155829287 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATAACTAGAGTCGGGTCAAGG -3'
(R):5'- TGAGCTCCATTGTCCCAAG -3'

Sequencing Primer
(F):5'- ATGAGGGTCTCCAAAGCCCTTC -3'
(R):5'- TCCATTGTCCCAAGGCCAC -3'
Posted On2018-06-06