Mutagenetix > Incidental Mutations

Incidental Mutation 'R6563:Cyp4a14'

522527

Institutional Source

Beutler Lab

Gene Symbol

Cyp4a14

Ensembl Gene

ENSMUSG00000028715

Gene Name

cytochrome P450, family 4, subfamily a, polypeptide 14

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R6563 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115486200-115496142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115492086 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 259 (H259L)

Ref Sequence

ENSEMBL: ENSMUSP00000030487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030487]

Predicted Effect

probably benign
Transcript: ENSMUST00000030487
AA Change: H259L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: H259L

Domain	Start	End	E-Value	Type
transmembrane domain	15	32	N/A	INTRINSIC
Pfam:p450	51	503	5.4e-129	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124412

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Diexf	C	A	1: 193,118,390	R374L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Irs1	T	A	1: 82,288,407	N696I	probably damaging	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
L3mbtl3	A	C	10: 26,302,863		probably null	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Ltbp4	A	T	7: 27,309,063	N1273K	probably damaging	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Terf2ip	G	T	8: 112,018,202	V384F	probably damaging	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tspoap1	A	G	11: 87,777,159	E1263G	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,501	A68V	probably benign	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in Cyp4a14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Cyp4a14	APN	4	115489952	splice site	probably benign
IGL01539:Cyp4a14	APN	4	115487177	missense	possibly damaging	0.71
IGL01802:Cyp4a14	APN	4	115494937	nonsense	probably null
IGL02309:Cyp4a14	APN	4	115491632	missense	probably damaging	0.99
IGL02330:Cyp4a14	APN	4	115495027	splice site	probably benign
IGL03302:Cyp4a14	APN	4	115491378	missense	probably benign	0.00
R1037:Cyp4a14	UTSW	4	115489996	missense	probably damaging	1.00
R1236:Cyp4a14	UTSW	4	115492170	missense	probably benign	0.01
R2132:Cyp4a14	UTSW	4	115491391	missense	probably damaging	1.00
R2133:Cyp4a14	UTSW	4	115491391	missense	probably damaging	1.00
R2870:Cyp4a14	UTSW	4	115487301	missense	probably damaging	1.00
R2870:Cyp4a14	UTSW	4	115487301	missense	probably damaging	1.00
R2871:Cyp4a14	UTSW	4	115487301	missense	probably damaging	1.00
R2871:Cyp4a14	UTSW	4	115487301	missense	probably damaging	1.00
R2872:Cyp4a14	UTSW	4	115487301	missense	probably damaging	1.00
R2872:Cyp4a14	UTSW	4	115487301	missense	probably damaging	1.00
R2873:Cyp4a14	UTSW	4	115487301	missense	probably damaging	1.00
R4015:Cyp4a14	UTSW	4	115491134	missense	probably damaging	1.00
R4925:Cyp4a14	UTSW	4	115495936	missense	possibly damaging	0.68
R5104:Cyp4a14	UTSW	4	115495929	missense	probably damaging	1.00
R5135:Cyp4a14	UTSW	4	115489960	critical splice donor site	probably null
R5150:Cyp4a14	UTSW	4	115493609	missense	probably damaging	1.00
R5930:Cyp4a14	UTSW	4	115491410	missense	probably damaging	1.00
R5997:Cyp4a14	UTSW	4	115496100	nonsense	probably null
R6269:Cyp4a14	UTSW	4	115491131	missense	possibly damaging	0.87
R6354:Cyp4a14	UTSW	4	115487244	missense	probably damaging	1.00
R6377:Cyp4a14	UTSW	4	115496083	missense	probably benign	0.01
R6534:Cyp4a14	UTSW	4	115489959	splice site	probably null
R6751:Cyp4a14	UTSW	4	115491194	missense	probably damaging	0.99
R7039:Cyp4a14	UTSW	4	115491081	missense	probably benign	0.23
R7125:Cyp4a14	UTSW	4	115491161	missense	probably damaging	1.00
R7379:Cyp4a14	UTSW	4	115493710	splice site	probably null
R7544:Cyp4a14	UTSW	4	115491086	missense	probably damaging	0.98
R7591:Cyp4a14	UTSW	4	115489960	critical splice donor site	probably null
R7740:Cyp4a14	UTSW	4	115493609	missense	probably damaging	1.00
R7741:Cyp4a14	UTSW	4	115489959	splice site	probably null
R7753:Cyp4a14	UTSW	4	115493664	missense	probably damaging	1.00
R7789:Cyp4a14	UTSW	4	115494910	missense	probably benign	0.00
R8064:Cyp4a14	UTSW	4	115494958	missense	probably benign
R8311:Cyp4a14	UTSW	4	115491078	missense	probably damaging	1.00
R8458:Cyp4a14	UTSW	4	115495932	missense	probably damaging	1.00
Z1176:Cyp4a14	UTSW	4	115490017	missense	probably benign	0.01
Z1177:Cyp4a14	UTSW	4	115491453	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATGTCACCAATCTAGTAAAGCTGG -3'
(R):5'- GGTAAGCCACCCTAATCTCCAG -3'

Sequencing Primer
(F):5'- CACCAATCTAGTAAAGCTGGTGGTG -3'
(R):5'- AGCCACCCTAATCTCCAGTATATTG -3'

Posted On

2018-06-06