Incidental Mutation 'R6563:2410131K14Rik'
ID 522531
Institutional Source Beutler Lab
Gene Symbol 2410131K14Rik
Ensembl Gene ENSMUSG00000032840
Gene Name RIKEN cDNA 2410131K14 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock # R6563 (G1)
Quality Score 212.009
Status Validated
Chromosome 5
Chromosomal Location 118245227-118266093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118258982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000043410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049138]
AlphaFold Q8BTG6
Predicted Effect possibly damaging
Transcript: ENSMUST00000049138
AA Change: V92A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043410
Gene: ENSMUSG00000032840
AA Change: V92A

DomainStartEndE-ValueType
transmembrane domain 17 35 N/A INTRINSIC
Pfam:DUF2054 70 195 2e-48 PFAM
Meta Mutation Damage Score 0.5130 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in 2410131K14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:2410131K14Rik APN 5 118259397 missense probably damaging 0.99
IGL02491:2410131K14Rik APN 5 118259095 missense probably benign 0.00
R0454:2410131K14Rik UTSW 5 118255821 missense possibly damaging 0.89
R0606:2410131K14Rik UTSW 5 118259089 missense probably damaging 1.00
R4628:2410131K14Rik UTSW 5 118259414 missense probably damaging 1.00
R5874:2410131K14Rik UTSW 5 118259439 missense probably damaging 0.99
R6030:2410131K14Rik UTSW 5 118255733 missense probably damaging 0.98
R6030:2410131K14Rik UTSW 5 118255733 missense probably damaging 0.98
R7148:2410131K14Rik UTSW 5 118255694 missense probably benign 0.00
R9621:2410131K14Rik UTSW 5 118255815 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGACTGAGGGGTCCAACTTC -3'
(R):5'- TCAGAACACTGCAGGAGATG -3'

Sequencing Primer
(F):5'- GGGGTCCAACTTCCCGTCATC -3'
(R):5'- GGAGATGCCTAGCTACCCC -3'
Posted On 2018-06-06