Incidental Mutation 'R6563:Vmn2r24'
ID522533
Institutional Source Beutler Lab
Gene Symbol Vmn2r24
Ensembl Gene ENSMUSG00000072780
Gene Namevomeronasal 2, receptor 24
SynonymsEG243628
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123778971-123816280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123804178 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 448 (N448Y)
Ref Sequence ENSEMBL: ENSMUSP00000074602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075095
AA Change: N448Y

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074602
Gene: ENSMUSG00000072780
AA Change: N448Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 469 1.6e-32 PFAM
Pfam:NCD3G 518 571 1.1e-22 PFAM
Pfam:7tm_3 602 839 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157847
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Other mutations in Vmn2r24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r24 APN 6 123815637 missense probably damaging 1.00
IGL01382:Vmn2r24 APN 6 123786979 missense possibly damaging 0.62
IGL01592:Vmn2r24 APN 6 123787486 missense probably benign 0.30
IGL01754:Vmn2r24 APN 6 123804161 missense probably damaging 1.00
IGL01939:Vmn2r24 APN 6 123787445 missense probably benign
IGL02140:Vmn2r24 APN 6 123780672 missense probably damaging 0.98
IGL02272:Vmn2r24 APN 6 123786884 missense possibly damaging 0.94
IGL02568:Vmn2r24 APN 6 123815853 missense probably benign 0.36
IGL02748:Vmn2r24 APN 6 123816098 missense possibly damaging 0.90
IGL03022:Vmn2r24 APN 6 123779008 missense probably damaging 0.99
IGL03343:Vmn2r24 APN 6 123816111 missense probably damaging 1.00
R0357:Vmn2r24 UTSW 6 123815410 frame shift probably null
R0453:Vmn2r24 UTSW 6 123780391 critical splice acceptor site probably null
R0538:Vmn2r24 UTSW 6 123816053 missense probably benign 0.32
R0607:Vmn2r24 UTSW 6 123786934 missense probably benign
R1381:Vmn2r24 UTSW 6 123786733 missense probably damaging 1.00
R1589:Vmn2r24 UTSW 6 123806520 splice site probably benign
R1848:Vmn2r24 UTSW 6 123816224 missense probably damaging 1.00
R2035:Vmn2r24 UTSW 6 123816060 missense probably damaging 1.00
R2077:Vmn2r24 UTSW 6 123815399 missense probably damaging 1.00
R2122:Vmn2r24 UTSW 6 123815394 missense possibly damaging 0.81
R2145:Vmn2r24 UTSW 6 123779013 missense probably benign
R2483:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R2512:Vmn2r24 UTSW 6 123787026 missense probably benign 0.01
R3001:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3002:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3236:Vmn2r24 UTSW 6 123779025 nonsense probably null
R3623:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3624:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3835:Vmn2r24 UTSW 6 123787453 missense probably benign 0.33
R4074:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4075:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4812:Vmn2r24 UTSW 6 123779185 missense probably benign 0.00
R4825:Vmn2r24 UTSW 6 123815780 missense probably benign 0.02
R5351:Vmn2r24 UTSW 6 123816264 missense possibly damaging 0.80
R5665:Vmn2r24 UTSW 6 123786979 missense possibly damaging 0.62
R5790:Vmn2r24 UTSW 6 123815540 missense probably benign
R5808:Vmn2r24 UTSW 6 123815638 nonsense probably null
R5879:Vmn2r24 UTSW 6 123787267 missense possibly damaging 0.89
R5923:Vmn2r24 UTSW 6 123815792 missense probably damaging 0.96
R5969:Vmn2r24 UTSW 6 123779022 missense probably benign 0.00
R6050:Vmn2r24 UTSW 6 123815732 missense probably damaging 1.00
R6171:Vmn2r24 UTSW 6 123787246 missense probably damaging 0.98
R6174:Vmn2r24 UTSW 6 123816277 missense probably benign 0.00
R6356:Vmn2r24 UTSW 6 123806409 missense possibly damaging 0.93
R6562:Vmn2r24 UTSW 6 123780427 missense probably benign 0.01
R6584:Vmn2r24 UTSW 6 123815805 missense possibly damaging 0.53
R6630:Vmn2r24 UTSW 6 123787022 missense probably benign 0.00
R6803:Vmn2r24 UTSW 6 123779001 missense possibly damaging 0.64
R6864:Vmn2r24 UTSW 6 123779158 missense possibly damaging 0.89
R7252:Vmn2r24 UTSW 6 123787232 missense possibly damaging 0.90
R7369:Vmn2r24 UTSW 6 123815679 missense probably damaging 0.99
R7646:Vmn2r24 UTSW 6 123816210 missense probably benign 0.20
R7799:Vmn2r24 UTSW 6 123780463 missense probably benign 0.00
R7803:Vmn2r24 UTSW 6 123780479 missense probably benign 0.00
R7959:Vmn2r24 UTSW 6 123778990 missense possibly damaging 0.86
R8215:Vmn2r24 UTSW 6 123779118 missense probably benign 0.10
RF006:Vmn2r24 UTSW 6 123806419 missense probably damaging 1.00
RF016:Vmn2r24 UTSW 6 123804215 missense probably benign 0.04
X0023:Vmn2r24 UTSW 6 123787400 missense probably damaging 0.99
Z1088:Vmn2r24 UTSW 6 123804196 missense probably benign 0.00
Z1177:Vmn2r24 UTSW 6 123786760 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTAACCTCTACATATTGACCTACTG -3'
(R):5'- ACCTGATTGTGGTGTTCACC -3'

Sequencing Primer
(F):5'- GACCTACTGCTAGCATGTATTAGC -3'
(R):5'- GGTGTTCACCCCAAGTTATGAGC -3'
Posted On2018-06-06