Incidental Mutation 'R6563:Kmt5c'
ID522535
Institutional Source Beutler Lab
Gene Symbol Kmt5c
Ensembl Gene ENSMUSG00000059851
Gene Namelysine methyltransferase 5C
SynonymsSuv4-20h2, Suv420h2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4740115-4747514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4742629 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 96 (Y96C)
Ref Sequence ENSEMBL: ENSMUSP00000119323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098853] [ENSMUST00000108582] [ENSMUST00000108583] [ENSMUST00000128018] [ENSMUST00000130215] [ENSMUST00000160480]
Predicted Effect probably damaging
Transcript: ENSMUST00000098853
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096452
Gene: ENSMUSG00000059851
AA Change: Y96C

DomainStartEndE-ValueType
Blast:SET 6 50 1e-10 BLAST
SET 110 224 1.17e-14 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108582
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104223
Gene: ENSMUSG00000059851
AA Change: Y96C

DomainStartEndE-ValueType
Blast:SET 6 50 1e-10 BLAST
SET 110 224 1.17e-14 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108583
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104224
Gene: ENSMUSG00000059851
AA Change: Y96C

DomainStartEndE-ValueType
Blast:SET 6 50 1e-10 BLAST
SET 110 224 1.17e-14 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128018
SMART Domains Protein: ENSMUSP00000114445
Gene: ENSMUSG00000059851

DomainStartEndE-ValueType
Blast:SET 1 32 4e-15 BLAST
PDB:4AU7|B 1 54 5e-33 PDB
low complexity region 76 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130200
Predicted Effect probably damaging
Transcript: ENSMUST00000130215
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119323
Gene: ENSMUSG00000059851
AA Change: Y96C

DomainStartEndE-ValueType
PDB:4AU7|B 1 164 1e-110 PDB
Blast:SET 32 133 5e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157950
Predicted Effect possibly damaging
Transcript: ENSMUST00000160480
AA Change: T41A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124663
Gene: ENSMUSG00000059851
AA Change: T41A

DomainStartEndE-ValueType
PDB:4AU7|B 1 36 2e-18 PDB
Blast:SET 6 36 3e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUV420H2 and the related enzyme SUV420H1 (MIM 610881) function as histone methyltransferases that specifically trimethylate nucleosomal histone H4 (see MIM 602822) on lysine-20 (K20) (Schotta et al., 2004 [PubMed 15145825]).[supplied by OMIM, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects and develop normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Kmt5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Kmt5c APN 7 4742141 nonsense probably null
R0010:Kmt5c UTSW 7 4746208 missense probably benign 0.09
R0349:Kmt5c UTSW 7 4746595 missense probably damaging 0.98
R0400:Kmt5c UTSW 7 4746244 missense probably benign 0.02
R1402:Kmt5c UTSW 7 4742253 missense possibly damaging 0.62
R1402:Kmt5c UTSW 7 4742253 missense possibly damaging 0.62
R1599:Kmt5c UTSW 7 4741900 missense probably damaging 1.00
R1657:Kmt5c UTSW 7 4746454 nonsense probably null
R1799:Kmt5c UTSW 7 4742730 critical splice donor site probably null
R1892:Kmt5c UTSW 7 4742715 nonsense probably null
R3855:Kmt5c UTSW 7 4746256 missense probably damaging 1.00
R5982:Kmt5c UTSW 7 4746791 missense probably damaging 1.00
R6306:Kmt5c UTSW 7 4746481 missense probably benign 0.35
R6357:Kmt5c UTSW 7 4742205 missense possibly damaging 0.94
R7106:Kmt5c UTSW 7 4742706 missense probably damaging 1.00
R7904:Kmt5c UTSW 7 4746159 missense probably damaging 0.99
Z1177:Kmt5c UTSW 7 4746700 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTCCATCTAGCTGGCAG -3'
(R):5'- AGGTTGTCCTGTGTCACTAACC -3'

Sequencing Primer
(F):5'- AGCTGGCAGATTCTAGATCTCTCAG -3'
(R):5'- GTCACTAACCCCACTTTCCCTGG -3'
Posted On2018-06-06