Mutagenetix > Incidental Mutations

Incidental Mutation 'R6563:Ltbp4'

522539

Institutional Source

Beutler Lab

Gene Symbol

Ltbp4

Ensembl Gene

ENSMUSG00000040488

Gene Name

latent transforming growth factor beta binding protein 4

Synonyms

2310046A13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6563 (G1)

Quality Score

195.009

Status

Validated

Chromosome

Chromosomal Location

27305136-27337692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27309063 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1273 (N1273K)

Ref Sequence

ENSEMBL: ENSMUSP00000113523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000118961] [ENSMUST00000121175] [ENSMUST00000125455]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038618
AA Change: N1339K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: N1339K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	112	125	N/A	INTRINSIC
EGF	151	180	2.74e-3	SMART
low complexity region	244	265	N/A	INTRINSIC
EGF_CA	356	396	3.51e-10	SMART
Pfam:TB	416	457	4.8e-15	PFAM
low complexity region	490	501	N/A	INTRINSIC
low complexity region	507	568	N/A	INTRINSIC
low complexity region	579	590	N/A	INTRINSIC
EGF	591	629	6.06e-5	SMART
EGF_CA	630	671	8.3e-12	SMART
EGF_CA	672	713	7.34e-13	SMART
EGF_CA	714	751	8.43e-13	SMART
EGF_CA	753	794	1.66e-11	SMART
EGF_CA	795	836	3.61e-12	SMART
EGF_CA	837	876	5.61e-9	SMART
EGF_CA	877	919	1.73e-9	SMART
EGF_CA	920	961	7.12e-11	SMART
EGF_CA	962	1002	3.56e-11	SMART
EGF_CA	1003	1046	1.61e-9	SMART
EGF_CA	1047	1090	2.13e-9	SMART
EGF_CA	1091	1132	1.02e-11	SMART
EGF	1136	1175	1.69e1	SMART
low complexity region	1185	1223	N/A	INTRINSIC
Pfam:TB	1234	1276	1.7e-13	PFAM
EGF_CA	1295	1337	2.72e-7	SMART
EGF_CA	1338	1379	1.36e-7	SMART
Pfam:TB	1402	1443	4.3e-14	PFAM
low complexity region	1449	1461	N/A	INTRINSIC
low complexity region	1478	1500	N/A	INTRINSIC
EGF	1578	1615	6.06e-5	SMART
EGF_CA	1616	1660	9.54e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108369
AA Change: N1338K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: N1338K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	116	145	N/A	INTRINSIC
EGF	150	179	2.74e-3	SMART
low complexity region	243	264	N/A	INTRINSIC
EGF_CA	355	395	3.51e-10	SMART
Pfam:TB	414	456	2.5e-14	PFAM
low complexity region	489	500	N/A	INTRINSIC
low complexity region	506	567	N/A	INTRINSIC
low complexity region	578	589	N/A	INTRINSIC
EGF	590	628	6.06e-5	SMART
EGF_CA	629	670	8.3e-12	SMART
EGF_CA	671	712	7.34e-13	SMART
EGF_CA	713	750	8.43e-13	SMART
EGF_CA	752	793	1.66e-11	SMART
EGF_CA	794	835	3.61e-12	SMART
EGF_CA	836	875	5.61e-9	SMART
EGF_CA	876	918	1.73e-9	SMART
EGF_CA	919	960	7.12e-11	SMART
EGF_CA	961	1001	3.56e-11	SMART
EGF_CA	1002	1045	1.61e-9	SMART
EGF_CA	1046	1089	2.13e-9	SMART
EGF_CA	1090	1131	1.02e-11	SMART
EGF	1135	1174	1.69e1	SMART
low complexity region	1184	1222	N/A	INTRINSIC
Pfam:TB	1232	1275	2.4e-13	PFAM
EGF_CA	1294	1336	2.72e-7	SMART
EGF_CA	1337	1378	1.36e-7	SMART
Pfam:TB	1400	1442	7.6e-15	PFAM
low complexity region	1448	1460	N/A	INTRINSIC
low complexity region	1477	1499	N/A	INTRINSIC
EGF	1577	1614	6.06e-5	SMART
EGF_CA	1615	1659	9.54e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000118583
AA Change: N1273K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488
AA Change: N1273K

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	2.3e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART
low complexity region	1119	1157	N/A	INTRINSIC
Pfam:TB	1167	1210	2.2e-13	PFAM
EGF_CA	1229	1271	2.72e-7	SMART
EGF_CA	1272	1313	1.36e-7	SMART
Pfam:TB	1335	1377	7.1e-15	PFAM
low complexity region	1383	1395	N/A	INTRINSIC
low complexity region	1412	1434	N/A	INTRINSIC
EGF	1512	1549	6.06e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118961

SMART Domains

Protein: ENSMUSP00000113746
Gene: ENSMUSG00000040488

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	1.6e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121175
AA Change: N1273K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: N1273K

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	3.4e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART
low complexity region	1119	1157	N/A	INTRINSIC
Pfam:TB	1167	1210	3.3e-13	PFAM
EGF_CA	1229	1271	2.72e-7	SMART
EGF_CA	1272	1313	1.36e-7	SMART
Pfam:TB	1335	1377	1e-14	PFAM
low complexity region	1383	1395	N/A	INTRINSIC
low complexity region	1412	1434	N/A	INTRINSIC
EGF	1512	1549	6.06e-5	SMART
EGF_CA	1550	1594	9.54e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125455

SMART Domains

Protein: ENSMUSP00000120326
Gene: ENSMUSG00000040488

Domain	Start	End	E-Value	Type
Pfam:TB	9	52	1.9e-14	PFAM
Pfam:TB	85	127	6e-16	PFAM
low complexity region	133	145	N/A	INTRINSIC
low complexity region	162	184	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148594

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206413

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Cyp4a14	T	A	4: 115,492,086	H259L	probably benign	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Diexf	C	A	1: 193,118,390	R374L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Irs1	T	A	1: 82,288,407	N696I	probably damaging	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
L3mbtl3	A	C	10: 26,302,863		probably null	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Terf2ip	G	T	8: 112,018,202	V384F	probably damaging	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tspoap1	A	G	11: 87,777,159	E1263G	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,501	A68V	probably benign	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in Ltbp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Ltbp4	APN	7	27328805	missense	probably damaging	0.96
IGL00585:Ltbp4	APN	7	27326733	missense	probably damaging	0.98
IGL01320:Ltbp4	APN	7	27328359	splice site	probably benign
IGL01860:Ltbp4	APN	7	27319646	missense	probably damaging	1.00
IGL02026:Ltbp4	APN	7	27327417	nonsense	probably null
IGL02226:Ltbp4	APN	7	27306934	missense	probably damaging	1.00
IGL02422:Ltbp4	APN	7	27319672	missense	probably damaging	1.00
IGL02611:Ltbp4	APN	7	27310655	missense	probably damaging	1.00
IGL02892:Ltbp4	APN	7	27310649	missense	probably damaging	1.00
IGL02926:Ltbp4	APN	7	27328872	splice site	probably null
IGL02950:Ltbp4	APN	7	27306718	missense	probably damaging	0.99
IGL03008:Ltbp4	APN	7	27324364	missense	probably damaging	0.99
IGL03271:Ltbp4	APN	7	27329815	missense	unknown
IGL02837:Ltbp4	UTSW	7	27314381	missense	probably damaging	1.00
R0792:Ltbp4	UTSW	7	27325060	missense	probably damaging	1.00
R0980:Ltbp4	UTSW	7	27324162	missense	probably damaging	1.00
R1017:Ltbp4	UTSW	7	27306076	missense	possibly damaging	0.95
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1403:Ltbp4	UTSW	7	27329039	missense	unknown
R1403:Ltbp4	UTSW	7	27329039	missense	unknown
R1448:Ltbp4	UTSW	7	27306577	missense	possibly damaging	0.86
R1575:Ltbp4	UTSW	7	27322820	missense	probably damaging	1.00
R1918:Ltbp4	UTSW	7	27337569	unclassified	probably benign
R1932:Ltbp4	UTSW	7	27307766	critical splice donor site	probably null
R1959:Ltbp4	UTSW	7	27329018	missense	unknown
R1960:Ltbp4	UTSW	7	27329018	missense	unknown
R1976:Ltbp4	UTSW	7	27326770	missense	probably damaging	1.00
R2060:Ltbp4	UTSW	7	27308953	missense	probably damaging	1.00
R2333:Ltbp4	UTSW	7	27327778	missense	possibly damaging	0.82
R2431:Ltbp4	UTSW	7	27319676	missense	possibly damaging	0.91
R3125:Ltbp4	UTSW	7	27327778	missense	possibly damaging	0.82
R4093:Ltbp4	UTSW	7	27325216	missense	possibly damaging	0.93
R4095:Ltbp4	UTSW	7	27325216	missense	possibly damaging	0.93
R4592:Ltbp4	UTSW	7	27325183	missense	probably damaging	0.96
R4610:Ltbp4	UTSW	7	27306700	missense	probably damaging	1.00
R4650:Ltbp4	UTSW	7	27314309	missense	probably damaging	1.00
R4912:Ltbp4	UTSW	7	27306116	nonsense	probably null
R5002:Ltbp4	UTSW	7	27327685	frame shift	probably null
R5016:Ltbp4	UTSW	7	27327685	frame shift	probably null
R5216:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5218:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5219:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5219:Ltbp4	UTSW	7	27327321	missense	probably benign	0.01
R5539:Ltbp4	UTSW	7	27327724	missense	probably damaging	0.97
R5991:Ltbp4	UTSW	7	27309316	missense	probably damaging	1.00
R6082:Ltbp4	UTSW	7	27335680	unclassified	probably benign
R6125:Ltbp4	UTSW	7	27327755	missense	probably damaging	1.00
R6146:Ltbp4	UTSW	7	27319724	missense	probably damaging	0.99
R6156:Ltbp4	UTSW	7	27330162	missense	unknown
R6414:Ltbp4	UTSW	7	27310715	missense	probably damaging	1.00
R6719:Ltbp4	UTSW	7	27328763	missense	probably damaging	0.99
R6940:Ltbp4	UTSW	7	27308944	missense	probably damaging	1.00
R7054:Ltbp4	UTSW	7	27307766	critical splice donor site	probably null
R7116:Ltbp4	UTSW	7	27305427	missense	probably damaging	0.99
R7326:Ltbp4	UTSW	7	27329755	missense	unknown
R7419:Ltbp4	UTSW	7	27329767	missense	unknown
R8068:Ltbp4	UTSW	7	27324168	missense	probably damaging	0.99
R8435:Ltbp4	UTSW	7	27335445	missense	unknown
R8543:Ltbp4	UTSW	7	27325241	missense	possibly damaging	0.84
X0025:Ltbp4	UTSW	7	27325802	missense	probably damaging	1.00
X0066:Ltbp4	UTSW	7	27306065	critical splice donor site	probably null
Z1088:Ltbp4	UTSW	7	27307792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGCCTAGAGATCTACAGGCTGG -3'
(R):5'- TACTATCACGCACACAGGCTG -3'

Sequencing Primer
(F):5'- CCTAGAGATCTACAGGCTGGGAGAG -3'
(R):5'- AGTGCGTTGGTATGAGCCCC -3'

Posted On

2018-06-06