Incidental Mutation 'R6563:Mfsd13b'
ID522545
Institutional Source Beutler Lab
Gene Symbol Mfsd13b
Ensembl Gene ENSMUSG00000030877
Gene Namemajor facilitator superfamily domain containing 13B
Synonyms4933427G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120982509-121014787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120995467 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 321 (A321T)
Ref Sequence ENSEMBL: ENSMUSP00000150654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033166] [ENSMUST00000149535] [ENSMUST00000216241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033166
AA Change: A321T

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033166
Gene: ENSMUSG00000030877
AA Change: A321T

DomainStartEndE-ValueType
Pfam:MFS_2 9 439 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133939
AA Change: A59T

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121409
Gene: ENSMUSG00000030877
AA Change: A59T

DomainStartEndE-ValueType
transmembrane domain 48 67 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149535
SMART Domains Protein: ENSMUSP00000115341
Gene: ENSMUSG00000030877

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216241
AA Change: A321T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Mfsd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Mfsd13b APN 7 120998909 missense probably damaging 1.00
IGL02985:Mfsd13b APN 7 121000172 missense probably damaging 1.00
R1159:Mfsd13b UTSW 7 121014543 missense probably damaging 0.98
R2041:Mfsd13b UTSW 7 120991916 splice site probably benign
R2080:Mfsd13b UTSW 7 120991824 missense probably null
R4762:Mfsd13b UTSW 7 120991326 missense probably damaging 1.00
R4885:Mfsd13b UTSW 7 120991488 missense possibly damaging 0.80
R5082:Mfsd13b UTSW 7 120998978 missense possibly damaging 0.94
R5282:Mfsd13b UTSW 7 120991833 missense probably damaging 0.98
R5296:Mfsd13b UTSW 7 120991738 missense probably damaging 1.00
R5411:Mfsd13b UTSW 7 121000123 missense probably benign 0.03
R7347:Mfsd13b UTSW 7 120991728 missense probably benign 0.44
Z1176:Mfsd13b UTSW 7 120991677 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TAAGCTGTGATGCAACAGGTGG -3'
(R):5'- GTGGCTCATGCTGCTAACTC -3'

Sequencing Primer
(F):5'- TGCAACAGGTGGTGTAATCC -3'
(R):5'- GCTAACTCCAGCTACTCAAATTAAAG -3'
Posted On2018-06-06