Incidental Mutation 'R6563:Terf2ip'
ID 522547
Institutional Source Beutler Lab
Gene Symbol Terf2ip
Ensembl Gene ENSMUSG00000033430
Gene Name telomeric repeat binding factor 2, interacting protein
Synonyms Rap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6563 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 112011398-112020528 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 112018202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 384 (V384F)
Ref Sequence ENSEMBL: ENSMUSP00000052170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052138] [ENSMUST00000071732]
AlphaFold Q91VL8
Predicted Effect probably damaging
Transcript: ENSMUST00000052138
AA Change: V384F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052170
Gene: ENSMUSG00000033430
AA Change: V384F

DomainStartEndE-ValueType
Pfam:BRCT_2 17 100 1.4e-23 PFAM
Pfam:Myb_DNA-bind_2 129 193 3.9e-35 PFAM
low complexity region 279 298 N/A INTRINSIC
Pfam:Rap1_C 315 392 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071732
SMART Domains Protein: ENSMUSP00000128163
Gene: ENSMUSG00000092086

DomainStartEndE-ValueType
RRM 14 86 3.1e-26 SMART
RRM 105 177 8.1e-24 SMART
low complexity region 192 310 N/A INTRINSIC
low complexity region 321 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212732
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that is part of a complex involved in telomere length regulation. Pseudogenes are present on chromosomes 5 and 22. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. Mice homozygous for a gene trapped allele die prior to E6.5 while heterozygous mice are resistant to LPS-induced mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Terf2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Terf2ip APN 8 112012068 missense probably benign
R0244:Terf2ip UTSW 8 112018164 missense possibly damaging 0.73
R0544:Terf2ip UTSW 8 112015342 missense possibly damaging 0.88
R0617:Terf2ip UTSW 8 112011495 missense probably benign 0.10
R0976:Terf2ip UTSW 8 112011717 missense probably damaging 0.98
R1709:Terf2ip UTSW 8 112011606 frame shift probably null
R2078:Terf2ip UTSW 8 112015403 missense probably benign 0.02
R2134:Terf2ip UTSW 8 112011639 missense possibly damaging 0.71
R4572:Terf2ip UTSW 8 112012017 missense probably damaging 1.00
R6172:Terf2ip UTSW 8 112018017 missense probably damaging 1.00
R6266:Terf2ip UTSW 8 112011915 missense probably damaging 1.00
R7180:Terf2ip UTSW 8 112011420 unclassified probably benign
R7203:Terf2ip UTSW 8 112017986 missense probably benign 0.30
R7222:Terf2ip UTSW 8 112011915 missense possibly damaging 0.64
R7304:Terf2ip UTSW 8 112011648 missense possibly damaging 0.86
R7787:Terf2ip UTSW 8 112015455 missense probably damaging 0.96
R7938:Terf2ip UTSW 8 112012085 missense possibly damaging 0.87
R8089:Terf2ip UTSW 8 112011792 missense probably benign 0.21
R8969:Terf2ip UTSW 8 112011738 missense probably damaging 0.98
R9376:Terf2ip UTSW 8 112011882 missense probably damaging 0.98
R9376:Terf2ip UTSW 8 112017896 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCAACAGTTACACAGGCCTTG -3'
(R):5'- AGGGGATACTTGCCATGGAC -3'

Sequencing Primer
(F):5'- TTACACAGGCCTTGCTGAAG -3'
(R):5'- ATGGACGGCTCTAATTCCAG -3'
Posted On 2018-06-06