Mutagenetix > Incidental Mutations

Incidental Mutation 'R6563:Terf2ip'

522547

Institutional Source

Beutler Lab

Gene Symbol

Terf2ip

Ensembl Gene

ENSMUSG00000033430

Gene Name

telomeric repeat binding factor 2, interacting protein

Synonyms

Rap1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6563 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112011398-112020528 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 112018202 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 384 (V384F)

Ref Sequence

ENSEMBL: ENSMUSP00000052170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052138] [ENSMUST00000071732]

Predicted Effect

probably damaging
Transcript: ENSMUST00000052138
AA Change: V384F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052170
Gene: ENSMUSG00000033430
AA Change: V384F

Domain	Start	End	E-Value	Type
Pfam:BRCT_2	17	100	1.4e-23	PFAM
Pfam:Myb_DNA-bind_2	129	193	3.9e-35	PFAM
low complexity region	279	298	N/A	INTRINSIC
Pfam:Rap1_C	315	392	2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000071732

SMART Domains

Protein: ENSMUSP00000128163
Gene: ENSMUSG00000092086

Domain	Start	End	E-Value	Type
RRM	14	86	3.1e-26	SMART
RRM	105	177	8.1e-24	SMART
low complexity region	192	310	N/A	INTRINSIC
low complexity region	321	350	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212732

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that is part of a complex involved in telomere length regulation. Pseudogenes are present on chromosomes 5 and 22. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. Mice homozygous for a gene trapped allele die prior to E6.5 while heterozygous mice are resistant to LPS-induced mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Cyp4a14	T	A	4: 115,492,086	H259L	probably benign	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Diexf	C	A	1: 193,118,390	R374L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Irs1	T	A	1: 82,288,407	N696I	probably damaging	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
L3mbtl3	A	C	10: 26,302,863		probably null	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Ltbp4	A	T	7: 27,309,063	N1273K	probably damaging	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tspoap1	A	G	11: 87,777,159	E1263G	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,501	A68V	probably benign	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in Terf2ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01901:Terf2ip	APN	8	112012068	missense	probably benign
R0244:Terf2ip	UTSW	8	112018164	missense	possibly damaging	0.73
R0544:Terf2ip	UTSW	8	112015342	missense	possibly damaging	0.88
R0617:Terf2ip	UTSW	8	112011495	missense	probably benign	0.10
R0976:Terf2ip	UTSW	8	112011717	missense	probably damaging	0.98
R1709:Terf2ip	UTSW	8	112011606	frame shift	probably null
R2078:Terf2ip	UTSW	8	112015403	missense	probably benign	0.02
R2134:Terf2ip	UTSW	8	112011639	missense	possibly damaging	0.71
R4572:Terf2ip	UTSW	8	112012017	missense	probably damaging	1.00
R6172:Terf2ip	UTSW	8	112018017	missense	probably damaging	1.00
R6266:Terf2ip	UTSW	8	112011915	missense	probably damaging	1.00
R7180:Terf2ip	UTSW	8	112011420	unclassified	probably benign
R7203:Terf2ip	UTSW	8	112017986	missense	probably benign	0.30
R7222:Terf2ip	UTSW	8	112011915	missense	possibly damaging	0.64
R7304:Terf2ip	UTSW	8	112011648	missense	possibly damaging	0.86
R7787:Terf2ip	UTSW	8	112015455	missense	probably damaging	0.96
R7938:Terf2ip	UTSW	8	112012085	missense	possibly damaging	0.87
R8089:Terf2ip	UTSW	8	112011792	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- ATCAACAGTTACACAGGCCTTG -3'
(R):5'- AGGGGATACTTGCCATGGAC -3'

Sequencing Primer
(F):5'- TTACACAGGCCTTGCTGAAG -3'
(R):5'- ATGGACGGCTCTAATTCCAG -3'

Posted On

2018-06-06