Incidental Mutation 'R6563:Atg4d'
ID 522551
Institutional Source Beutler Lab
Gene Symbol Atg4d
Ensembl Gene ENSMUSG00000002820
Gene Name autophagy related 4D, cysteine peptidase
Synonyms 9830134P12Rik, APG4-D, Apg4d, Autl4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6563 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21265293-21277772 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21268460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 235 (L235F)
Ref Sequence ENSEMBL: ENSMUSP00000068450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038671] [ENSMUST00000065005]
AlphaFold Q8BGV9
Predicted Effect probably benign
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000065005
AA Change: L235F

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068450
Gene: ENSMUSG00000002820
AA Change: L235F

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Peptidase_C54 109 411 5.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216826
Predicted Effect probably benign
Transcript: ENSMUST00000217269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217591
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene belongs to the autophagy-related protein 4 (Atg4) family of C54 endopeptidases. Members of this family encode proteins that play a role in the biogenesis of autophagosomes, which sequester the cytosol and organelles for degradation by lysosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Atg4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Atg4d APN 9 21266921 missense probably damaging 1.00
BB006:Atg4d UTSW 9 21266964 missense probably null 0.82
BB016:Atg4d UTSW 9 21266964 missense probably null 0.82
R1393:Atg4d UTSW 9 21270833 missense probably damaging 1.00
R1455:Atg4d UTSW 9 21270801 missense probably damaging 1.00
R1724:Atg4d UTSW 9 21268445 missense probably damaging 1.00
R1912:Atg4d UTSW 9 21272639 missense probably damaging 1.00
R2497:Atg4d UTSW 9 21273386 nonsense probably null
R5366:Atg4d UTSW 9 21268652 missense probably damaging 1.00
R6709:Atg4d UTSW 9 21268648 missense probably damaging 1.00
R7929:Atg4d UTSW 9 21266964 missense probably null 0.82
R8263:Atg4d UTSW 9 21267039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACAGTTTAGCTCTCAGTG -3'
(R):5'- TTCTGAGCAACTCTCCACAGC -3'

Sequencing Primer
(F):5'- TGGCTTCCTCTGAGATGCCAG -3'
(R):5'- GAGCAACTCTCCACAGCTTTCC -3'
Posted On 2018-06-06