Incidental Mutation 'R6563:Snx3'
ID522555
Institutional Source Beutler Lab
Gene Symbol Snx3
Ensembl Gene ENSMUSG00000019804
Gene Namesorting nexin 3
SynonymsSDP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location42502030-42535381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42526036 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000019939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019939] [ENSMUST00000105499] [ENSMUST00000105500]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019939
AA Change: E82G

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019939
Gene: ENSMUSG00000019804
AA Change: E82G

DomainStartEndE-ValueType
PX 26 148 9.8e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105499
SMART Domains Protein: ENSMUSP00000101138
Gene: ENSMUSG00000019804

DomainStartEndE-ValueType
PX 26 116 3.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105500
AA Change: E60G

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101139
Gene: ENSMUSG00000019804
AA Change: E60G

DomainStartEndE-ValueType
PX 3 126 1.85e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Snx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02904:Snx3 APN 10 42534694 missense probably damaging 1.00
sorta UTSW 10 42534731 nonsense probably null
R0574:Snx3 UTSW 10 42502387 missense probably benign 0.00
R0582:Snx3 UTSW 10 42533280 splice site probably benign
R6112:Snx3 UTSW 10 42526046 missense probably benign 0.12
R6375:Snx3 UTSW 10 42534731 nonsense probably null
R7978:Snx3 UTSW 10 42502350 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAACCATGTTTGTCACCTTATCAG -3'
(R):5'- CCAGTTGCACTACTGAGCAG -3'

Sequencing Primer
(F):5'- ACCTTATCAGTGTGCCAGAC -3'
(R):5'- CTCTGAACAGTGAGGACGACTGTC -3'
Posted On2018-06-06