Incidental Mutation 'R6563:Olfr57'
ID522557
Institutional Source Beutler Lab
Gene Symbol Olfr57
Ensembl Gene ENSMUSG00000060205
Gene Nameolfactory receptor 57
SynonymsGA_x6K02T2QGN0-2777431-2776472, IF12, MOR139-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79028741-79036274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79035217 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 140 (R140S)
Ref Sequence ENSEMBL: ENSMUSP00000144814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082244] [ENSMUST00000203906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082244
AA Change: R140S

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080872
Gene: ENSMUSG00000060205
AA Change: R140S

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.2e-49 PFAM
Pfam:7tm_1 42 291 6e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203906
AA Change: R140S

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144814
Gene: ENSMUSG00000060205
AA Change: R140S

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Olfr57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr57 APN 10 79035611 missense probably benign 0.05
IGL02230:Olfr57 APN 10 79035042 missense probably damaging 0.99
IGL02283:Olfr57 APN 10 79035545 missense probably damaging 1.00
IGL02878:Olfr57 APN 10 79035558 missense probably benign 0.23
IGL02975:Olfr57 APN 10 79035033 missense possibly damaging 0.83
IGL03259:Olfr57 APN 10 79035400 nonsense probably null
R1366:Olfr57 UTSW 10 79035042 missense probably damaging 1.00
R1438:Olfr57 UTSW 10 79035288 missense possibly damaging 0.88
R1528:Olfr57 UTSW 10 79035564 missense probably damaging 0.96
R1601:Olfr57 UTSW 10 79035504 missense possibly damaging 0.56
R2032:Olfr57 UTSW 10 79035329 missense possibly damaging 0.86
R2112:Olfr57 UTSW 10 79035414 missense probably damaging 1.00
R2382:Olfr57 UTSW 10 79035134 missense possibly damaging 0.52
R2967:Olfr57 UTSW 10 79035053 missense probably damaging 1.00
R3773:Olfr57 UTSW 10 79035180 missense possibly damaging 0.95
R3940:Olfr57 UTSW 10 79035204 missense probably damaging 1.00
R4405:Olfr57 UTSW 10 79035410 missense probably benign
R5944:Olfr57 UTSW 10 79035389 missense probably benign 0.00
R6614:Olfr57 UTSW 10 79035091 nonsense probably null
R7181:Olfr57 UTSW 10 79035453 missense probably damaging 0.98
R7639:Olfr57 UTSW 10 79035372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGGTAAACATTCACACAC -3'
(R):5'- CTGCACTGAGGAGATTGCAC -3'

Sequencing Primer
(F):5'- GCTGGTAAACATTCACACACAAAGC -3'
(R):5'- CTGCACTGAGGAGATTGCACAAATG -3'
Posted On2018-06-06