Incidental Mutation 'R6488:Ntrk2'
ID522560
Institutional Source Beutler Lab
Gene Symbol Ntrk2
Ensembl Gene ENSMUSG00000055254
Gene Nameneurotrophic tyrosine kinase, receptor, type 2
SynonymsC030027L06Rik, Tkrb, trkB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R6488 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location58806569-59133970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58861356 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 320 (N320K)
Ref Sequence ENSEMBL: ENSMUSP00000153152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000109838] [ENSMUST00000224259] [ENSMUST00000224402] [ENSMUST00000225488] [ENSMUST00000225583] [ENSMUST00000225950]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079828
AA Change: N320K

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: N320K

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.2e-8 PFAM
transmembrane domain 431 453 N/A INTRINSIC
TyrKc 537 806 2.48e-142 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109838
AA Change: N320K

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105464
Gene: ENSMUSG00000055254
AA Change: N320K

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.1e-8 PFAM
Pfam:Ig_2 300 377 5.4e-4 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224259
AA Change: N320K

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224402
AA Change: N320K

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225488
AA Change: N320K

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225583
AA Change: N320K

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225950
AA Change: N320K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
4933406M09Rik T A 1: 134,390,888 V466D probably damaging Het
Abhd15 T C 11: 77,516,022 F275S possibly damaging Het
Adamts7 A G 9: 90,171,482 T27A probably benign Het
Ankar A G 1: 72,681,808 probably null Het
Ap2a2 T C 7: 141,602,307 V183A probably benign Het
Arhgef37 G A 18: 61,518,052 A134V probably benign Het
Col3a1 C A 1: 45,331,534 probably benign Het
Cxcr5 A G 9: 44,513,979 V127A probably damaging Het
Eif4b T A 15: 102,092,987 probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fam83h T C 15: 76,002,053 E1145G possibly damaging Het
Fcgbp A G 7: 28,093,538 D989G probably damaging Het
Fchsd1 T C 18: 37,967,268 probably null Het
Fcnb T C 2: 28,078,289 K219E probably damaging Het
Fndc7 T C 3: 108,870,575 E355G probably damaging Het
Glis3 T C 19: 28,298,853 H746R probably benign Het
Glod4 A G 11: 76,237,785 V74A probably damaging Het
Gm10436 T C 12: 88,177,587 H152R possibly damaging Het
Gpc6 T C 14: 117,964,713 I445T possibly damaging Het
Hdlbp T C 1: 93,428,224 D337G probably damaging Het
Hnf1a T C 5: 114,955,961 T190A probably benign Het
Iqgap1 G C 7: 80,730,326 T1129R probably benign Het
Kcnc3 T C 7: 44,595,182 F299L possibly damaging Het
Kif1bp C A 10: 62,559,658 probably null Het
Kif26b T C 1: 178,529,573 V4A unknown Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap4-1 G T 11: 99,628,077 R36S unknown Het
Lman1l A G 9: 57,620,643 S10P possibly damaging Het
Lrpprc T C 17: 84,751,353 N693S probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mga T A 2: 119,960,907 N2424K probably damaging Het
Mpdz G T 4: 81,287,733 A1784E probably benign Het
Mpv17l G A 16: 13,946,588 probably null Het
Mtus1 G A 8: 41,041,508 S29L possibly damaging Het
Myo15 A T 11: 60,478,487 H691L possibly damaging Het
Nbea T C 3: 55,717,843 T2276A probably damaging Het
Npas4 A G 19: 4,985,983 S718P probably damaging Het
Nup214 T A 2: 31,991,372 I414N possibly damaging Het
Oas2 A G 5: 120,738,363 F15S probably damaging Het
Olfr1474 T C 19: 13,471,617 Y216H probably damaging Het
Olfr625-ps1 T C 7: 103,683,078 I110T probably damaging Het
Pabpc6 A G 17: 9,669,599 Y8H probably damaging Het
Pbx1 T A 1: 168,191,395 N294Y probably damaging Het
Pcyt1a T C 16: 32,467,081 M190T probably damaging Het
Pogk T C 1: 166,399,422 I387V possibly damaging Het
Ppp6r2 T C 15: 89,268,538 L294P probably benign Het
Ptprn2 T A 12: 116,872,038 I331K probably benign Het
Ptpro T G 6: 137,393,675 Y591* probably null Het
Ptprz1 T A 6: 23,001,517 L1202* probably null Het
Rab37 A G 11: 115,157,963 T73A probably benign Het
Rad51ap2 T G 12: 11,458,160 S694R possibly damaging Het
Rb1cc1 T A 1: 6,270,727 D148E probably damaging Het
Rraga G A 4: 86,576,328 R137H probably damaging Het
Serpinf2 A G 11: 75,437,503 V73A probably benign Het
Siglec1 T C 2: 131,081,307 N506S probably damaging Het
Slc35e4 T C 11: 3,912,602 T196A possibly damaging Het
St6galnac3 C T 3: 153,411,757 A110T probably damaging Het
Thsd1 T C 8: 22,243,717 V260A probably benign Het
Tpbg T A 9: 85,844,485 V169D possibly damaging Het
Trav16n A G 14: 53,351,585 E106G probably benign Het
Vmn1r219 T C 13: 23,162,965 I108T probably benign Het
Vmn2r50 T C 7: 10,037,717 I686V probably damaging Het
Zdhhc20 C T 14: 57,840,832 R329K probably benign Het
Zfp64 A G 2: 168,935,209 probably null Het
Zfp941 C T 7: 140,812,750 R232H probably benign Het
Other mutations in Ntrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Ntrk2 APN 13 58846851 missense probably damaging 1.00
IGL02331:Ntrk2 APN 13 58846856 critical splice donor site probably null
IGL02465:Ntrk2 APN 13 59060380 missense probably damaging 1.00
PIT4366001:Ntrk2 UTSW 13 59060335 missense probably damaging 1.00
R0102:Ntrk2 UTSW 13 58808793 missense probably benign 0.00
R0547:Ntrk2 UTSW 13 58874370 missense probably damaging 0.99
R0615:Ntrk2 UTSW 13 59128186 nonsense probably null
R0620:Ntrk2 UTSW 13 58846821 missense probably benign
R1770:Ntrk2 UTSW 13 58861318 missense possibly damaging 0.67
R2063:Ntrk2 UTSW 13 58859297 missense probably damaging 1.00
R2089:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2178:Ntrk2 UTSW 13 58808802 missense probably benign 0.06
R2275:Ntrk2 UTSW 13 58861351 missense probably damaging 1.00
R2370:Ntrk2 UTSW 13 59054434 missense probably benign 0.28
R2413:Ntrk2 UTSW 13 58874412 missense possibly damaging 0.56
R2520:Ntrk2 UTSW 13 59054276 intron probably null
R2926:Ntrk2 UTSW 13 59060284 missense probably damaging 1.00
R4163:Ntrk2 UTSW 13 58860240 missense probably damaging 1.00
R4320:Ntrk2 UTSW 13 58860146 missense possibly damaging 0.48
R4348:Ntrk2 UTSW 13 58878259 missense probably damaging 1.00
R4440:Ntrk2 UTSW 13 59060312 missense probably damaging 1.00
R4534:Ntrk2 UTSW 13 59126529 missense probably damaging 1.00
R4695:Ntrk2 UTSW 13 59126493 missense probably damaging 0.99
R5356:Ntrk2 UTSW 13 59060242 missense probably damaging 1.00
R5471:Ntrk2 UTSW 13 58871760 missense probably benign 0.01
R5750:Ntrk2 UTSW 13 58808922 missense probably benign 0.02
R5916:Ntrk2 UTSW 13 58808729 start codon destroyed probably null 0.98
R5972:Ntrk2 UTSW 13 58837819 missense probably damaging 1.00
R6015:Ntrk2 UTSW 13 59060395 missense probably damaging 1.00
R6298:Ntrk2 UTSW 13 58871756 nonsense probably null
R6419:Ntrk2 UTSW 13 58861299 nonsense probably null
R6611:Ntrk2 UTSW 13 59054414 missense probably damaging 1.00
R6827:Ntrk2 UTSW 13 59126568 missense probably damaging 1.00
R6911:Ntrk2 UTSW 13 58859215 missense probably damaging 1.00
R7387:Ntrk2 UTSW 13 58985979 missense probably damaging 1.00
R7445:Ntrk2 UTSW 13 58846762 missense probably benign 0.03
R7561:Ntrk2 UTSW 13 58861388 missense probably benign 0.31
R8031:Ntrk2 UTSW 13 58874379 missense probably benign
R8044:Ntrk2 UTSW 13 59126499 missense probably damaging 1.00
Z1176:Ntrk2 UTSW 13 58874333 missense probably benign
Z1177:Ntrk2 UTSW 13 58859273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGAGGATTCTGAGCTTTC -3'
(R):5'- TACACACCGTAGTCGACTCC -3'

Sequencing Primer
(F):5'- CTGAGCTTTCTGGTGCTATTAAC -3'
(R):5'- GGCCCATGAAGTGAGCG -3'
Posted On2018-06-06