Incidental Mutation 'R6563:Pwwp2a'
ID522561
Institutional Source Beutler Lab
Gene Symbol Pwwp2a
Ensembl Gene ENSMUSG00000044950
Gene NamePWWP domain containing 2A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location43681998-43721491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43705765 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 586 (A586S)
Ref Sequence ENSEMBL: ENSMUSP00000054154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061070] [ENSMUST00000094294] [ENSMUST00000109280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061070
AA Change: A586S

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054154
Gene: ENSMUSG00000044950
AA Change: A586S

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 488 509 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 566 576 N/A INTRINSIC
low complexity region 588 598 N/A INTRINSIC
Pfam:PWWP 628 714 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094294
SMART Domains Protein: ENSMUSP00000091852
Gene: ENSMUSG00000044950

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109280
AA Change: A311S

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104903
Gene: ENSMUSG00000044950
AA Change: A311S

DomainStartEndE-ValueType
low complexity region 213 234 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Pfam:PWWP 353 438 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129229
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Pwwp2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Pwwp2a APN 11 43706128 missense possibly damaging 0.46
IGL02227:Pwwp2a APN 11 43705621 missense possibly damaging 0.93
IGL02653:Pwwp2a APN 11 43706035 missense possibly damaging 0.69
IGL03258:Pwwp2a APN 11 43704565 missense probably benign 0.21
R0376:Pwwp2a UTSW 11 43704672 missense probably benign 0.00
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R2127:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2128:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2173:Pwwp2a UTSW 11 43682486 missense probably benign 0.01
R3077:Pwwp2a UTSW 11 43705385 missense probably damaging 1.00
R3436:Pwwp2a UTSW 11 43706188 nonsense probably null
R3437:Pwwp2a UTSW 11 43706188 nonsense probably null
R4427:Pwwp2a UTSW 11 43682517 missense possibly damaging 0.52
R5597:Pwwp2a UTSW 11 43682595 missense probably benign 0.34
R5672:Pwwp2a UTSW 11 43706141 missense probably damaging 1.00
R6132:Pwwp2a UTSW 11 43705628 missense probably damaging 1.00
R6197:Pwwp2a UTSW 11 43704596 missense probably benign 0.00
R6709:Pwwp2a UTSW 11 43704727 missense probably damaging 1.00
R7049:Pwwp2a UTSW 11 43706191 missense probably damaging 0.99
R7305:Pwwp2a UTSW 11 43717051 missense probably damaging 0.98
R7351:Pwwp2a UTSW 11 43682280 missense probably benign 0.12
R7767:Pwwp2a UTSW 11 43705869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGACACAAGCAGAGTGC -3'
(R):5'- ACCAAGGGAAGCCATATATCTTG -3'

Sequencing Primer
(F):5'- AAGCAGAGTGCGTGTGCC -3'
(R):5'- TATATCTTGGCCCAAACAATGTCC -3'
Posted On2018-06-06