Incidental Mutation 'R6563:Pwwp2a'
ID 522561
Institutional Source Beutler Lab
Gene Symbol Pwwp2a
Ensembl Gene ENSMUSG00000044950
Gene Name PWWP domain containing 2A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock # R6563 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 43681998-43721491 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43705765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 586 (A586S)
Ref Sequence ENSEMBL: ENSMUSP00000054154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061070] [ENSMUST00000094294] [ENSMUST00000109280]
AlphaFold Q69Z61
Predicted Effect possibly damaging
Transcript: ENSMUST00000061070
AA Change: A586S

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054154
Gene: ENSMUSG00000044950
AA Change: A586S

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 488 509 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 566 576 N/A INTRINSIC
low complexity region 588 598 N/A INTRINSIC
Pfam:PWWP 628 714 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094294
SMART Domains Protein: ENSMUSP00000091852
Gene: ENSMUSG00000044950

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109280
AA Change: A311S

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104903
Gene: ENSMUSG00000044950
AA Change: A311S

DomainStartEndE-ValueType
low complexity region 213 234 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Pfam:PWWP 353 438 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129229
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Pwwp2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Pwwp2a APN 11 43706128 missense possibly damaging 0.46
IGL02227:Pwwp2a APN 11 43705621 missense possibly damaging 0.93
IGL02653:Pwwp2a APN 11 43706035 missense possibly damaging 0.69
IGL03258:Pwwp2a APN 11 43704565 missense probably benign 0.21
R0376:Pwwp2a UTSW 11 43704672 missense probably benign 0.00
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R2127:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2128:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2173:Pwwp2a UTSW 11 43682486 missense probably benign 0.01
R3077:Pwwp2a UTSW 11 43705385 missense probably damaging 1.00
R3436:Pwwp2a UTSW 11 43706188 nonsense probably null
R3437:Pwwp2a UTSW 11 43706188 nonsense probably null
R4427:Pwwp2a UTSW 11 43682517 missense possibly damaging 0.52
R5597:Pwwp2a UTSW 11 43682595 missense probably benign 0.34
R5672:Pwwp2a UTSW 11 43706141 missense probably damaging 1.00
R6132:Pwwp2a UTSW 11 43705628 missense probably damaging 1.00
R6197:Pwwp2a UTSW 11 43704596 missense probably benign 0.00
R6709:Pwwp2a UTSW 11 43704727 missense probably damaging 1.00
R7049:Pwwp2a UTSW 11 43706191 missense probably damaging 0.99
R7305:Pwwp2a UTSW 11 43717051 missense probably damaging 0.98
R7351:Pwwp2a UTSW 11 43682280 missense probably benign 0.12
R7767:Pwwp2a UTSW 11 43705869 missense probably damaging 1.00
R8921:Pwwp2a UTSW 11 43705517 missense probably damaging 0.96
R9144:Pwwp2a UTSW 11 43705894 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAGGACACAAGCAGAGTGC -3'
(R):5'- ACCAAGGGAAGCCATATATCTTG -3'

Sequencing Primer
(F):5'- AAGCAGAGTGCGTGTGCC -3'
(R):5'- TATATCTTGGCCCAAACAATGTCC -3'
Posted On 2018-06-06