Mutagenetix > Incidental Mutations

Incidental Mutation 'R6563:Tspoap1'

522563

Institutional Source

Beutler Lab

Gene Symbol

Tspoap1

Ensembl Gene

ENSMUSG00000034156

Gene Name

TSPO associated protein 1

Synonyms

Bzrap1, peripheral

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6563 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87760541-87785928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87777159 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1263 (E1263G)

Ref Sequence

ENSEMBL: ENSMUSP00000048063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039627
AA Change: E1263G

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: E1263G

Domain	Start	End	E-Value	Type
coiled coil region	121	190	N/A	INTRINSIC
coiled coil region	219	249	N/A	INTRINSIC
low complexity region	301	309	N/A	INTRINSIC
coiled coil region	331	519	N/A	INTRINSIC
low complexity region	598	612	N/A	INTRINSIC
low complexity region	625	638	N/A	INTRINSIC
SH3	652	715	1.85e-11	SMART
low complexity region	733	759	N/A	INTRINSIC
FN3	784	864	3.14e0	SMART
FN3	878	951	4.81e-4	SMART
FN3	975	1062	7.16e0	SMART
low complexity region	1254	1265	N/A	INTRINSIC
low complexity region	1301	1313	N/A	INTRINSIC
low complexity region	1387	1401	N/A	INTRINSIC
low complexity region	1455	1471	N/A	INTRINSIC
SH3	1619	1683	5.4e-13	SMART
low complexity region	1721	1732	N/A	INTRINSIC
SH3	1758	1821	5.48e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100644
AA Change: E1203G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: E1203G

Domain	Start	End	E-Value	Type
coiled coil region	121	190	N/A	INTRINSIC
low complexity region	241	249	N/A	INTRINSIC
coiled coil region	271	459	N/A	INTRINSIC
low complexity region	538	552	N/A	INTRINSIC
low complexity region	565	578	N/A	INTRINSIC
SH3	592	655	1.85e-11	SMART
low complexity region	673	699	N/A	INTRINSIC
FN3	724	804	3.14e0	SMART
FN3	818	891	4.81e-4	SMART
FN3	915	1002	7.16e0	SMART
low complexity region	1194	1205	N/A	INTRINSIC
low complexity region	1241	1253	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1395	1411	N/A	INTRINSIC
SH3	1559	1623	5.4e-13	SMART
low complexity region	1661	1672	N/A	INTRINSIC
SH3	1698	1761	5.48e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133645

SMART Domains

Protein: ENSMUSP00000117356
Gene: ENSMUSG00000034156

Domain	Start	End	E-Value	Type
low complexity region	39	50	N/A	INTRINSIC
SH3	88	151	5.48e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135957

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142329
AA Change: E80G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118819
Gene: ENSMUSG00000034156
AA Change: E80G

Domain	Start	End	E-Value	Type
low complexity region	72	83	N/A	INTRINSIC
SH3	157	221	5.4e-13	SMART
low complexity region	259	270	N/A	INTRINSIC
SH3	296	359	5.48e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144502
AA Change: E154G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122665
Gene: ENSMUSG00000034156
AA Change: E154G

Domain	Start	End	E-Value	Type
low complexity region	146	157	N/A	INTRINSIC
PDB:2CSQ\|A	223	250	8e-8	PDB
Blast:SH3	231	251	5e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148814

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153578

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154758

Meta Mutation Damage Score

0.0743

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

PHENOTYPE: Homozygous double-KO with Rimbp2^tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Cyp4a14	T	A	4: 115,492,086	H259L	probably benign	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Diexf	C	A	1: 193,118,390	R374L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Irs1	T	A	1: 82,288,407	N696I	probably damaging	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
L3mbtl3	A	C	10: 26,302,863		probably null	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Ltbp4	A	T	7: 27,309,063	N1273K	probably damaging	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Terf2ip	G	T	8: 112,018,202	V384F	probably damaging	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,501	A68V	probably benign	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in Tspoap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Tspoap1	APN	11	87777821	splice site	probably null
IGL01718:Tspoap1	APN	11	87780255	missense	possibly damaging	0.90
IGL02427:Tspoap1	APN	11	87762515	missense	probably benign	0.00
IGL02487:Tspoap1	APN	11	87762516	missense	possibly damaging	0.90
IGL02730:Tspoap1	APN	11	87781709	missense	probably damaging	0.98
IGL02979:Tspoap1	APN	11	87770521	missense	probably damaging	1.00
R0384:Tspoap1	UTSW	11	87766454	missense	probably damaging	1.00
R0396:Tspoap1	UTSW	11	87776346	splice site	probably benign
R0470:Tspoap1	UTSW	11	87776162	missense	probably damaging	0.99
R0637:Tspoap1	UTSW	11	87777240	splice site	probably benign
R0671:Tspoap1	UTSW	11	87762809	missense	probably damaging	1.00
R0960:Tspoap1	UTSW	11	87770595	splice site	probably benign
R0989:Tspoap1	UTSW	11	87765823	missense	probably damaging	0.99
R1396:Tspoap1	UTSW	11	87766120	missense	probably damaging	1.00
R1792:Tspoap1	UTSW	11	87765881	splice site	probably null
R2901:Tspoap1	UTSW	11	87777975	missense	probably benign	0.00
R2902:Tspoap1	UTSW	11	87777975	missense	probably benign	0.00
R3969:Tspoap1	UTSW	11	87762446	missense	probably damaging	1.00
R4400:Tspoap1	UTSW	11	87775603	missense	probably damaging	1.00
R4599:Tspoap1	UTSW	11	87779521	missense	probably damaging	1.00
R4635:Tspoap1	UTSW	11	87777857	missense	probably benign	0.25
R4731:Tspoap1	UTSW	11	87765647	missense	probably benign	0.09
R4755:Tspoap1	UTSW	11	87771663	missense	possibly damaging	0.77
R4780:Tspoap1	UTSW	11	87778443	missense	possibly damaging	0.48
R4960:Tspoap1	UTSW	11	87766396	nonsense	probably null
R5494:Tspoap1	UTSW	11	87775205	missense	possibly damaging	0.47
R5687:Tspoap1	UTSW	11	87777126	missense	probably damaging	1.00
R6200:Tspoap1	UTSW	11	87761703	missense	possibly damaging	0.85
R6816:Tspoap1	UTSW	11	87765665	missense	probably benign
R6897:Tspoap1	UTSW	11	87765812	missense	probably damaging	1.00
R7141:Tspoap1	UTSW	11	87774697	missense	probably damaging	1.00
R7215:Tspoap1	UTSW	11	87770489	missense	probably benign	0.02
R7341:Tspoap1	UTSW	11	87766379	missense	probably damaging	1.00
R7360:Tspoap1	UTSW	11	87778521	missense	probably benign	0.09
R7394:Tspoap1	UTSW	11	87766119	nonsense	probably null
R7483:Tspoap1	UTSW	11	87761525	missense	probably benign	0.00
R7617:Tspoap1	UTSW	11	87763625	missense	probably benign	0.02
R7793:Tspoap1	UTSW	11	87764310	missense	probably benign	0.00
R7814:Tspoap1	UTSW	11	87775524	missense	probably damaging	1.00
R8371:Tspoap1	UTSW	11	87778301	missense	probably benign	0.01
Z1176:Tspoap1	UTSW	11	87776057	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- TCCTGCCATAGCCTTCTGAG -3'
(R):5'- AATGAAATGTGCTCCCCTCTCC -3'

Sequencing Primer
(F):5'- CTGCCATAGCCTTCTGAGTATTAGG -3'
(R):5'- ACCACTTAGGATTGGACCCAGG -3'

Posted On

2018-06-06