Incidental Mutation 'R6563:Tspoap1'
ID522563
Institutional Source Beutler Lab
Gene Symbol Tspoap1
Ensembl Gene ENSMUSG00000034156
Gene NameTSPO associated protein 1
SynonymsBzrap1, peripheral
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87760541-87785928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87777159 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1263 (E1263G)
Ref Sequence ENSEMBL: ENSMUSP00000048063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039627
AA Change: E1263G

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: E1263G

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
coiled coil region 219 249 N/A INTRINSIC
low complexity region 301 309 N/A INTRINSIC
coiled coil region 331 519 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
SH3 652 715 1.85e-11 SMART
low complexity region 733 759 N/A INTRINSIC
FN3 784 864 3.14e0 SMART
FN3 878 951 4.81e-4 SMART
FN3 975 1062 7.16e0 SMART
low complexity region 1254 1265 N/A INTRINSIC
low complexity region 1301 1313 N/A INTRINSIC
low complexity region 1387 1401 N/A INTRINSIC
low complexity region 1455 1471 N/A INTRINSIC
SH3 1619 1683 5.4e-13 SMART
low complexity region 1721 1732 N/A INTRINSIC
SH3 1758 1821 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100644
AA Change: E1203G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: E1203G

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
low complexity region 241 249 N/A INTRINSIC
coiled coil region 271 459 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
SH3 592 655 1.85e-11 SMART
low complexity region 673 699 N/A INTRINSIC
FN3 724 804 3.14e0 SMART
FN3 818 891 4.81e-4 SMART
FN3 915 1002 7.16e0 SMART
low complexity region 1194 1205 N/A INTRINSIC
low complexity region 1241 1253 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1395 1411 N/A INTRINSIC
SH3 1559 1623 5.4e-13 SMART
low complexity region 1661 1672 N/A INTRINSIC
SH3 1698 1761 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133645
SMART Domains Protein: ENSMUSP00000117356
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
SH3 88 151 5.48e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135957
Predicted Effect possibly damaging
Transcript: ENSMUST00000142329
AA Change: E80G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118819
Gene: ENSMUSG00000034156
AA Change: E80G

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
SH3 157 221 5.4e-13 SMART
low complexity region 259 270 N/A INTRINSIC
SH3 296 359 5.48e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144502
AA Change: E154G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122665
Gene: ENSMUSG00000034156
AA Change: E154G

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
PDB:2CSQ|A 223 250 8e-8 PDB
Blast:SH3 231 251 5e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154758
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous double-KO with Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Tspoap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Tspoap1 APN 11 87777821 splice site probably null
IGL01718:Tspoap1 APN 11 87780255 missense possibly damaging 0.90
IGL02427:Tspoap1 APN 11 87762515 missense probably benign 0.00
IGL02487:Tspoap1 APN 11 87762516 missense possibly damaging 0.90
IGL02730:Tspoap1 APN 11 87781709 missense probably damaging 0.98
IGL02979:Tspoap1 APN 11 87770521 missense probably damaging 1.00
R0384:Tspoap1 UTSW 11 87766454 missense probably damaging 1.00
R0396:Tspoap1 UTSW 11 87776346 splice site probably benign
R0470:Tspoap1 UTSW 11 87776162 missense probably damaging 0.99
R0637:Tspoap1 UTSW 11 87777240 splice site probably benign
R0671:Tspoap1 UTSW 11 87762809 missense probably damaging 1.00
R0960:Tspoap1 UTSW 11 87770595 splice site probably benign
R0989:Tspoap1 UTSW 11 87765823 missense probably damaging 0.99
R1396:Tspoap1 UTSW 11 87766120 missense probably damaging 1.00
R1792:Tspoap1 UTSW 11 87765881 splice site probably null
R2901:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R2902:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R3969:Tspoap1 UTSW 11 87762446 missense probably damaging 1.00
R4400:Tspoap1 UTSW 11 87775603 missense probably damaging 1.00
R4599:Tspoap1 UTSW 11 87779521 missense probably damaging 1.00
R4635:Tspoap1 UTSW 11 87777857 missense probably benign 0.25
R4731:Tspoap1 UTSW 11 87765647 missense probably benign 0.09
R4755:Tspoap1 UTSW 11 87771663 missense possibly damaging 0.77
R4780:Tspoap1 UTSW 11 87778443 missense possibly damaging 0.48
R4960:Tspoap1 UTSW 11 87766396 nonsense probably null
R5494:Tspoap1 UTSW 11 87775205 missense possibly damaging 0.47
R5687:Tspoap1 UTSW 11 87777126 missense probably damaging 1.00
R6200:Tspoap1 UTSW 11 87761703 missense possibly damaging 0.85
R6816:Tspoap1 UTSW 11 87765665 missense probably benign
R6897:Tspoap1 UTSW 11 87765812 missense probably damaging 1.00
R7141:Tspoap1 UTSW 11 87774697 missense probably damaging 1.00
R7215:Tspoap1 UTSW 11 87770489 missense probably benign 0.02
R7341:Tspoap1 UTSW 11 87766379 missense probably damaging 1.00
R7360:Tspoap1 UTSW 11 87778521 missense probably benign 0.09
R7394:Tspoap1 UTSW 11 87766119 nonsense probably null
R7483:Tspoap1 UTSW 11 87761525 missense probably benign 0.00
R7617:Tspoap1 UTSW 11 87763625 missense probably benign 0.02
R7793:Tspoap1 UTSW 11 87764310 missense probably benign 0.00
R7814:Tspoap1 UTSW 11 87775524 missense probably damaging 1.00
R8371:Tspoap1 UTSW 11 87778301 missense probably benign 0.01
Z1176:Tspoap1 UTSW 11 87776057 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TCCTGCCATAGCCTTCTGAG -3'
(R):5'- AATGAAATGTGCTCCCCTCTCC -3'

Sequencing Primer
(F):5'- CTGCCATAGCCTTCTGAGTATTAGG -3'
(R):5'- ACCACTTAGGATTGGACCCAGG -3'
Posted On2018-06-06