Incidental Mutation 'R6488:Zdhhc20'
ID522564
Institutional Source Beutler Lab
Gene Symbol Zdhhc20
Ensembl Gene ENSMUSG00000021969
Gene Namezinc finger, DHHC domain containing 20
SynonymsB230110O18Rik, ENSMUSG00000055956, 5033406L14Rik, 4930542A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6488 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location57832703-57890276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57840832 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 329 (R329K)
Ref Sequence ENSEMBL: ENSMUSP00000153568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089473] [ENSMUST00000226057]
Predicted Effect probably benign
Transcript: ENSMUST00000089473
AA Change: R317K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086900
Gene: ENSMUSG00000021969
AA Change: R317K

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:zf-DHHC 121 250 2.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226029
Predicted Effect probably benign
Transcript: ENSMUST00000226057
AA Change: R329K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
4933406M09Rik T A 1: 134,390,888 V466D probably damaging Het
Abhd15 T C 11: 77,516,022 F275S possibly damaging Het
Adamts7 A G 9: 90,171,482 T27A probably benign Het
Ankar A G 1: 72,681,808 probably null Het
Ap2a2 T C 7: 141,602,307 V183A probably benign Het
Arhgef37 G A 18: 61,518,052 A134V probably benign Het
Col3a1 C A 1: 45,331,534 probably benign Het
Cxcr5 A G 9: 44,513,979 V127A probably damaging Het
Eif4b T A 15: 102,092,987 probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fam83h T C 15: 76,002,053 E1145G possibly damaging Het
Fcgbp A G 7: 28,093,538 D989G probably damaging Het
Fchsd1 T C 18: 37,967,268 probably null Het
Fcnb T C 2: 28,078,289 K219E probably damaging Het
Fndc7 T C 3: 108,870,575 E355G probably damaging Het
Glis3 T C 19: 28,298,853 H746R probably benign Het
Glod4 A G 11: 76,237,785 V74A probably damaging Het
Gm10436 T C 12: 88,177,587 H152R possibly damaging Het
Gpc6 T C 14: 117,964,713 I445T possibly damaging Het
Hdlbp T C 1: 93,428,224 D337G probably damaging Het
Hnf1a T C 5: 114,955,961 T190A probably benign Het
Iqgap1 G C 7: 80,730,326 T1129R probably benign Het
Kcnc3 T C 7: 44,595,182 F299L possibly damaging Het
Kif1bp C A 10: 62,559,658 probably null Het
Kif26b T C 1: 178,529,573 V4A unknown Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap4-1 G T 11: 99,628,077 R36S unknown Het
Lman1l A G 9: 57,620,643 S10P possibly damaging Het
Lrpprc T C 17: 84,751,353 N693S probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mga T A 2: 119,960,907 N2424K probably damaging Het
Mpdz G T 4: 81,287,733 A1784E probably benign Het
Mpv17l G A 16: 13,946,588 probably null Het
Mtus1 G A 8: 41,041,508 S29L possibly damaging Het
Myo15 A T 11: 60,478,487 H691L possibly damaging Het
Nbea T C 3: 55,717,843 T2276A probably damaging Het
Npas4 A G 19: 4,985,983 S718P probably damaging Het
Ntrk2 T A 13: 58,861,356 N320K possibly damaging Het
Nup214 T A 2: 31,991,372 I414N possibly damaging Het
Oas2 A G 5: 120,738,363 F15S probably damaging Het
Olfr1474 T C 19: 13,471,617 Y216H probably damaging Het
Olfr625-ps1 T C 7: 103,683,078 I110T probably damaging Het
Pabpc6 A G 17: 9,669,599 Y8H probably damaging Het
Pbx1 T A 1: 168,191,395 N294Y probably damaging Het
Pcyt1a T C 16: 32,467,081 M190T probably damaging Het
Pogk T C 1: 166,399,422 I387V possibly damaging Het
Ppp6r2 T C 15: 89,268,538 L294P probably benign Het
Ptprn2 T A 12: 116,872,038 I331K probably benign Het
Ptpro T G 6: 137,393,675 Y591* probably null Het
Ptprz1 T A 6: 23,001,517 L1202* probably null Het
Rab37 A G 11: 115,157,963 T73A probably benign Het
Rad51ap2 T G 12: 11,458,160 S694R possibly damaging Het
Rb1cc1 T A 1: 6,270,727 D148E probably damaging Het
Rraga G A 4: 86,576,328 R137H probably damaging Het
Serpinf2 A G 11: 75,437,503 V73A probably benign Het
Siglec1 T C 2: 131,081,307 N506S probably damaging Het
Slc35e4 T C 11: 3,912,602 T196A possibly damaging Het
St6galnac3 C T 3: 153,411,757 A110T probably damaging Het
Thsd1 T C 8: 22,243,717 V260A probably benign Het
Tpbg T A 9: 85,844,485 V169D possibly damaging Het
Trav16n A G 14: 53,351,585 E106G probably benign Het
Vmn1r219 T C 13: 23,162,965 I108T probably benign Het
Vmn2r50 T C 7: 10,037,717 I686V probably damaging Het
Zfp64 A G 2: 168,935,209 probably null Het
Zfp941 C T 7: 140,812,750 R232H probably benign Het
Other mutations in Zdhhc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zdhhc20 APN 14 57873924 missense probably damaging 0.99
IGL00983:Zdhhc20 APN 14 57839156 missense possibly damaging 0.62
IGL01107:Zdhhc20 APN 14 57865589 missense probably damaging 1.00
IGL01350:Zdhhc20 APN 14 57873987 missense probably benign 0.03
IGL02572:Zdhhc20 APN 14 57890107 missense probably benign 0.20
IGL02748:Zdhhc20 APN 14 57858553 missense probably benign 0.08
IGL03406:Zdhhc20 APN 14 57839099 missense probably benign
R0314:Zdhhc20 UTSW 14 57856619 missense probably damaging 1.00
R0631:Zdhhc20 UTSW 14 57857640 missense probably damaging 0.99
R1144:Zdhhc20 UTSW 14 57856678 missense probably benign 0.07
R1703:Zdhhc20 UTSW 14 57839088 critical splice donor site probably null
R1815:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R1816:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R6219:Zdhhc20 UTSW 14 57840883 missense probably damaging 0.99
R6650:Zdhhc20 UTSW 14 57858575 missense probably damaging 1.00
R6790:Zdhhc20 UTSW 14 57890143 missense probably benign 0.00
R7196:Zdhhc20 UTSW 14 57873891 critical splice donor site probably null
R7365:Zdhhc20 UTSW 14 57873920 missense possibly damaging 0.95
R8126:Zdhhc20 UTSW 14 57846945 missense probably damaging 1.00
R8832:Zdhhc20 UTSW 14 57843264 missense possibly damaging 0.86
R8832:Zdhhc20 UTSW 14 57865632 missense probably benign 0.05
Z1176:Zdhhc20 UTSW 14 57839105 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTTTTCCCAGACACTACAG -3'
(R):5'- TCATGCCTCTGAAAAGCAAATC -3'

Sequencing Primer
(F):5'- GGTTTTCCCAGACACTACAGATATGC -3'
(R):5'- GCCTCTGAAAAGCAAATCTTAAATTG -3'
Posted On2018-06-06