Incidental Mutation 'R6563:Srcin1'
ID522565
Institutional Source Beutler Lab
Gene Symbol Srcin1
Ensembl Gene ENSMUSG00000038453
Gene NameSRC kinase signaling inhibitor 1
Synonymsp140Cap, P140
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6563 (G1)
Quality Score112.008
Status Validated
Chromosome11
Chromosomal Location97509340-97576186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97534774 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 486 (Y486N)
Ref Sequence ENSEMBL: ENSMUSP00000103222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107590] [ENSMUST00000107593] [ENSMUST00000107596] [ENSMUST00000126287]
Predicted Effect probably benign
Transcript: ENSMUST00000107590
AA Change: Y487N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103216
Gene: ENSMUSG00000038453
AA Change: Y487N

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107593
AA Change: Y487N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103219
Gene: ENSMUSG00000038453
AA Change: Y487N

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107596
AA Change: Y486N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103222
Gene: ENSMUSG00000038453
AA Change: Y486N

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:THAP 79 108 8e-10 BLAST
low complexity region 118 128 N/A INTRINSIC
Pfam:AIP3 218 330 2e-11 PFAM
low complexity region 331 365 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 515 537 N/A INTRINSIC
low complexity region 557 574 N/A INTRINSIC
low complexity region 654 678 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
coiled coil region 750 783 N/A INTRINSIC
low complexity region 1033 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126287
SMART Domains Protein: ENSMUSP00000116444
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 7e-10 BLAST
low complexity region 152 162 N/A INTRINSIC
Pfam:AIP3 244 339 9.7e-10 PFAM
low complexity region 357 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in object recognition memory and motor learning, dendritic spine disorganization, impaired synaptic plasticity, and reduced long term potentiation and long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Srcin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Srcin1 APN 11 97533098 missense possibly damaging 0.81
IGL03347:Srcin1 APN 11 97525344 missense probably damaging 1.00
R1619:Srcin1 UTSW 11 97525481 missense probably damaging 1.00
R1678:Srcin1 UTSW 11 97518644 missense probably damaging 0.99
R1733:Srcin1 UTSW 11 97533501 missense probably benign
R2023:Srcin1 UTSW 11 97526046 missense probably benign
R2238:Srcin1 UTSW 11 97534819 missense probably benign 0.00
R3983:Srcin1 UTSW 11 97525553 missense probably damaging 1.00
R4572:Srcin1 UTSW 11 97534934 missense probably damaging 1.00
R4628:Srcin1 UTSW 11 97548926 missense probably benign 0.12
R4946:Srcin1 UTSW 11 97551942 missense probably damaging 1.00
R5175:Srcin1 UTSW 11 97573877 missense probably damaging 0.99
R5424:Srcin1 UTSW 11 97537059 nonsense probably null
R5705:Srcin1 UTSW 11 97548951 missense probably benign 0.42
R5918:Srcin1 UTSW 11 97533497 splice site probably null
R6613:Srcin1 UTSW 11 97533827 missense possibly damaging 0.94
R6756:Srcin1 UTSW 11 97535010 missense probably damaging 1.00
R6805:Srcin1 UTSW 11 97551980 critical splice acceptor site probably null
R7060:Srcin1 UTSW 11 97573885 missense probably damaging 0.99
R7271:Srcin1 UTSW 11 97551889 missense probably damaging 0.99
R7304:Srcin1 UTSW 11 97551693 missense probably benign 0.01
R7469:Srcin1 UTSW 11 97534609 missense probably damaging 0.98
R7567:Srcin1 UTSW 11 97534725 missense probably damaging 1.00
R7846:Srcin1 UTSW 11 97526100 nonsense probably null
R7994:Srcin1 UTSW 11 97531916 missense probably damaging 1.00
R8203:Srcin1 UTSW 11 97566713 missense probably damaging 1.00
R8377:Srcin1 UTSW 11 97551978 missense probably damaging 0.99
X0024:Srcin1 UTSW 11 97536468 missense probably damaging 1.00
Z1176:Srcin1 UTSW 11 97518727 missense possibly damaging 0.88
Z1177:Srcin1 UTSW 11 97526861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCGAATCTTTGCGGAAG -3'
(R):5'- TGAAGCCAGATGAGGACCTG -3'

Sequencing Primer
(F):5'- CCGAATCTTTGCGGAAGGACTG -3'
(R):5'- CATGGTGCTGGTGAAGGGC -3'
Posted On2018-06-06