Incidental Mutation 'R6563:Prkar2b'
ID522567
Institutional Source Beutler Lab
Gene Symbol Prkar2b
Ensembl Gene ENSMUSG00000002997
Gene Nameprotein kinase, cAMP dependent regulatory, type II beta
SynonymsRII(beta), Pkarb2, PKARIIbeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31958476-32061296 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 31993786 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000036497] [ENSMUST00000146865] [ENSMUST00000146865]
Predicted Effect probably null
Transcript: ENSMUST00000003079
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000003079
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036497
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036497
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146865
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146865
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Prkar2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Prkar2b APN 12 32061072 missense possibly damaging 0.55
IGL02056:Prkar2b APN 12 31975910 splice site probably benign
IGL02071:Prkar2b APN 12 31963017 missense probably damaging 1.00
IGL02118:Prkar2b APN 12 31975964 missense probably damaging 1.00
spark UTSW 12 31987974 splice site probably null
R0211:Prkar2b UTSW 12 31972184 missense probably benign 0.30
R0362:Prkar2b UTSW 12 31987974 splice site probably null
R0485:Prkar2b UTSW 12 31976035 splice site probably benign
R0898:Prkar2b UTSW 12 31963002 missense possibly damaging 0.90
R1426:Prkar2b UTSW 12 31962988 splice site probably benign
R1997:Prkar2b UTSW 12 31963935 missense probably damaging 0.99
R2114:Prkar2b UTSW 12 31967280 missense probably damaging 1.00
R2346:Prkar2b UTSW 12 31972150 missense probably benign 0.01
R2513:Prkar2b UTSW 12 31975929 missense possibly damaging 0.93
R3875:Prkar2b UTSW 12 31965123 missense probably benign 0.01
R5301:Prkar2b UTSW 12 31975928 missense probably damaging 1.00
R5316:Prkar2b UTSW 12 32060985 missense probably damaging 0.97
R5351:Prkar2b UTSW 12 31972127 missense probably damaging 1.00
R6025:Prkar2b UTSW 12 32060856 missense possibly damaging 0.68
R6028:Prkar2b UTSW 12 31993758 missense possibly damaging 0.50
R7074:Prkar2b UTSW 12 31972148 missense probably damaging 1.00
R7431:Prkar2b UTSW 12 31963151 splice site probably null
R7747:Prkar2b UTSW 12 32060938 missense probably benign 0.23
R7978:Prkar2b UTSW 12 31963025 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGTCTACAGAATCTGAAGTAGAAGC -3'
(R):5'- CTCCTTTGGAAGCCTGCATG -3'

Sequencing Primer
(F):5'- AAGCAGACTATTAAAATACGATGAGG -3'
(R):5'- GCATGGCACCTTCTGGTAC -3'
Posted On2018-06-06