Incidental Mutation 'R6563:Gphn'
ID522571
Institutional Source Beutler Lab
Gene Symbol Gphn
Ensembl Gene ENSMUSG00000047454
Gene Namegephyrin
Synonyms5730552E08Rik, geph
MMRRC Submission
Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location78226379-78684772 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 78680396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]
Predicted Effect probably null
Transcript: ENSMUST00000052472
SMART Domains Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 356 522 5.6e-53 PFAM
MoCF_biosynth 535 678 8.1e-38 SMART
Pfam:MoeA_C 691 766 8.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110388
SMART Domains Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 360 525 2.1e-35 PFAM
MoCF_biosynth 538 681 8.1e-38 SMART
Pfam:MoeA_C 694 769 8.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219629
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Gphn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gphn APN 12 78504632 missense probably damaging 1.00
IGL00701:Gphn APN 12 78626167 missense possibly damaging 0.93
IGL00844:Gphn APN 12 78664568 splice site probably benign
IGL01517:Gphn APN 12 78376374 missense probably damaging 1.00
IGL02499:Gphn APN 12 78492300 missense probably benign 0.17
IGL02827:Gphn APN 12 78609220 missense probably damaging 1.00
IGL03136:Gphn APN 12 78481333 missense possibly damaging 0.69
IGL03348:Gphn APN 12 78627119 missense probably damaging 0.99
IGL03382:Gphn APN 12 78481313 missense probably damaging 1.00
grizzlies UTSW 12 78654880 missense probably benign 0.28
3-1:Gphn UTSW 12 78613001 missense probably benign 0.06
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0212:Gphn UTSW 12 78637552 missense probably damaging 0.99
R0389:Gphn UTSW 12 78590659 missense probably damaging 1.00
R0535:Gphn UTSW 12 78492050 missense possibly damaging 0.90
R1464:Gphn UTSW 12 78612964 splice site probably benign
R1503:Gphn UTSW 12 78504629 missense possibly damaging 0.94
R1606:Gphn UTSW 12 78683883 missense probably damaging 1.00
R1896:Gphn UTSW 12 78412354 missense possibly damaging 0.74
R2248:Gphn UTSW 12 78454821 missense probably damaging 1.00
R3708:Gphn UTSW 12 78532693 missense probably benign
R3907:Gphn UTSW 12 78493942 splice site probably benign
R4537:Gphn UTSW 12 78494014 missense probably benign 0.03
R4667:Gphn UTSW 12 78454817 missense probably damaging 1.00
R4808:Gphn UTSW 12 78654880 missense probably benign 0.28
R4840:Gphn UTSW 12 78522955 critical splice donor site probably null
R4852:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4854:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4855:Gphn UTSW 12 78627210 missense probably damaging 1.00
R5083:Gphn UTSW 12 78623289 splice site probably null
R5224:Gphn UTSW 12 78590587 missense probably damaging 0.99
R5580:Gphn UTSW 12 78492044 missense probably damaging 1.00
R5626:Gphn UTSW 12 78683897 missense probably benign 0.11
R6270:Gphn UTSW 12 78522950 missense probably benign
R6943:Gphn UTSW 12 78492181 missense possibly damaging 0.88
R6958:Gphn UTSW 12 78680299 missense possibly damaging 0.86
R7170:Gphn UTSW 12 78683889 missense possibly damaging 0.67
R7295:Gphn UTSW 12 78492102 missense probably benign 0.02
R7514:Gphn UTSW 12 78626165 missense probably damaging 0.97
R7537:Gphn UTSW 12 78504680 missense possibly damaging 0.62
R7680:Gphn UTSW 12 78412374 missense probably benign 0.14
R8236:Gphn UTSW 12 78664537 missense probably damaging 1.00
R8377:Gphn UTSW 12 78664506 missense probably damaging 1.00
R8409:Gphn UTSW 12 78613010 missense probably damaging 1.00
R8468:Gphn UTSW 12 78226827 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CAATCACTTCTATCATGCCTGAATG -3'
(R):5'- TGAAGCCTTGTTCTCTGGATTC -3'

Sequencing Primer
(F):5'- CTATCATGCCTGAATGTATAAGCAG -3'
(R):5'- TCTATGTCCTCTGGAAGAACAGC -3'
Posted On2018-06-06