Incidental Mutation 'R6563:Cyp2d22'
ID522577
Institutional Source Beutler Lab
Gene Symbol Cyp2d22
Ensembl Gene ENSMUSG00000061740
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms2D22
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82370527-82380260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82371912 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 174 (W174R)
Ref Sequence ENSEMBL: ENSMUSP00000155368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023083] [ENSMUST00000228986]
Predicted Effect probably damaging
Transcript: ENSMUST00000023083
AA Change: W412R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023083
Gene: ENSMUSG00000061740
AA Change: W412R

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:p450 37 497 8.1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228986
AA Change: W174R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230663
Meta Mutation Damage Score 0.9677 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Cyp2d22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Cyp2d22 APN 15 82371668 missense probably damaging 1.00
IGL01750:Cyp2d22 APN 15 82374369 missense probably benign 0.12
IGL01801:Cyp2d22 APN 15 82372845 missense probably benign 0.41
IGL02449:Cyp2d22 APN 15 82373241 missense probably benign 0.00
ANU22:Cyp2d22 UTSW 15 82371668 missense probably damaging 1.00
R0165:Cyp2d22 UTSW 15 82373280 missense probably benign 0.06
R0294:Cyp2d22 UTSW 15 82374445 missense possibly damaging 0.86
R1381:Cyp2d22 UTSW 15 82372508 missense probably benign 0.00
R1479:Cyp2d22 UTSW 15 82371936 missense probably damaging 0.97
R1562:Cyp2d22 UTSW 15 82373978 missense probably damaging 0.99
R1968:Cyp2d22 UTSW 15 82373172 missense probably benign 0.04
R1972:Cyp2d22 UTSW 15 82375827 missense probably benign 0.11
R4492:Cyp2d22 UTSW 15 82374370 missense probably benign 0.00
R4575:Cyp2d22 UTSW 15 82371932 missense possibly damaging 0.94
R4702:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R4703:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R5344:Cyp2d22 UTSW 15 82371638 missense possibly damaging 0.95
R5523:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R5888:Cyp2d22 UTSW 15 82373813 missense probably benign
R6060:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
R6108:Cyp2d22 UTSW 15 82371905 missense possibly damaging 0.59
R6146:Cyp2d22 UTSW 15 82373835 critical splice acceptor site probably null
R6279:Cyp2d22 UTSW 15 82373968 missense probably damaging 1.00
R7597:Cyp2d22 UTSW 15 82375852 missense probably damaging 1.00
R7709:Cyp2d22 UTSW 15 82374411 missense possibly damaging 0.88
R7839:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R8094:Cyp2d22 UTSW 15 82374355 missense probably benign 0.19
R8302:Cyp2d22 UTSW 15 82371820 critical splice donor site probably null
R8515:Cyp2d22 UTSW 15 82373912 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CTGAGATGCTAAAGCGCTGC -3'
(R):5'- CCACTAGGGCTAGGGTTATATGAAAG -3'

Sequencing Primer
(F):5'- CATGATCTGCGGCCTGTG -3'
(R):5'- CTAGGGTTATATGAAAGGATCCAGTC -3'
Posted On2018-06-06