Incidental Mutation 'R6563:Krt77'
ID522579
Institutional Source Beutler Lab
Gene Symbol Krt77
Ensembl Gene ENSMUSG00000067594
Gene Namekeratin 77
Synonyms4732484G22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101858731-101869705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101862923 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 315 (T315N)
Ref Sequence ENSEMBL: ENSMUSP00000085311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087996]
Predicted Effect probably damaging
Transcript: ENSMUST00000087996
AA Change: T315N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085311
Gene: ENSMUSG00000067594
AA Change: T315N

DomainStartEndE-ValueType
Pfam:Keratin_2_head 4 163 1.5e-46 PFAM
Filament 166 479 6.11e-149 SMART
low complexity region 485 497 N/A INTRINSIC
low complexity region 500 543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229995
Meta Mutation Damage Score 0.2799 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in the skin and eccrine sweat glands. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Krt77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Krt77 APN 15 101860880 splice site probably benign
IGL01912:Krt77 APN 15 101863851 splice site probably benign
IGL02505:Krt77 APN 15 101860946 missense probably damaging 1.00
IGL02875:Krt77 APN 15 101869149 missense probably damaging 1.00
R0266:Krt77 UTSW 15 101869378 missense possibly damaging 0.71
R0347:Krt77 UTSW 15 101859869 missense unknown
R0762:Krt77 UTSW 15 101861126 intron probably null
R1528:Krt77 UTSW 15 101861088 missense probably damaging 1.00
R1556:Krt77 UTSW 15 101861278 missense probably damaging 0.96
R1973:Krt77 UTSW 15 101861244 missense probably damaging 1.00
R4434:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R4436:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R4946:Krt77 UTSW 15 101869563 missense unknown
R5405:Krt77 UTSW 15 101861088 missense probably damaging 0.96
R5507:Krt77 UTSW 15 101861230 missense probably benign 0.03
R5888:Krt77 UTSW 15 101865453 missense probably benign 0.29
R5978:Krt77 UTSW 15 101862928 missense probably benign 0.07
R5994:Krt77 UTSW 15 101862855 missense probably damaging 1.00
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6241:Krt77 UTSW 15 101865553 missense probably damaging 1.00
R6260:Krt77 UTSW 15 101864372 nonsense probably null
R6280:Krt77 UTSW 15 101865475 missense probably damaging 1.00
R6500:Krt77 UTSW 15 101864337 missense probably damaging 0.99
R7153:Krt77 UTSW 15 101865496 missense probably benign 0.18
R7156:Krt77 UTSW 15 101865496 missense probably benign 0.18
R7205:Krt77 UTSW 15 101869371 missense probably benign 0.00
R7379:Krt77 UTSW 15 101861274 missense probably damaging 1.00
R7407:Krt77 UTSW 15 101860095 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCAGGAGGCAATAGCAGTTTG -3'
(R):5'- TGCCCAGATGCCTTTAGTCC -3'

Sequencing Primer
(F):5'- TTTATTTGGGGGTGCAAACTCGAAAC -3'
(R):5'- GTCCTTACCTTTAGTCAAAACACAC -3'
Posted On2018-06-06