Mutagenetix > Incidental Mutation

Incidental Mutation 'R6563:Vmn1r225'

522581

Institutional Source

Beutler Lab

Gene Symbol

Vmn1r225

Ensembl Gene

ENSMUSG00000043537

Gene Name

vomeronasal 1 receptor 225

Synonyms

V1re5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R6563 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20502299-20503195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20502501 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 68 (A68V)

Ref Sequence

ENSEMBL: ENSMUSP00000056068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061660]

AlphaFold

Q8R2A5

Predicted Effect

probably benign
Transcript: ENSMUST00000061660
AA Change: A68V

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000056068
Gene: ENSMUSG00000043537
AA Change: A68V

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	287	8.9e-15	PFAM
Pfam:V1R	11	291	3.1e-24	PFAM

Meta Mutation Damage Score

0.1829

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Cyp4a14	T	A	4: 115,492,086	H259L	probably benign	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Diexf	C	A	1: 193,118,390	R374L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Irs1	T	A	1: 82,288,407	N696I	probably damaging	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
L3mbtl3	A	C	10: 26,302,863		probably null	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Ltbp4	A	T	7: 27,309,063	N1273K	probably damaging	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Terf2ip	G	T	8: 112,018,202	V384F	probably damaging	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tspoap1	A	G	11: 87,777,159	E1263G	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in Vmn1r225

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01093:Vmn1r225	APN	17	20502819	missense	probably damaging	1.00
IGL01830:Vmn1r225	APN	17	20502455	missense	probably damaging	0.96
IGL02943:Vmn1r225	APN	17	20502305	missense	possibly damaging	0.67
R0544:Vmn1r225	UTSW	17	20502456	missense	probably benign	0.44
R1126:Vmn1r225	UTSW	17	20502326	missense	probably benign	0.03
R1809:Vmn1r225	UTSW	17	20502656	missense	probably benign	0.04
R1928:Vmn1r225	UTSW	17	20502809	missense	probably benign	0.00
R2044:Vmn1r225	UTSW	17	20502590	missense	possibly damaging	0.50
R2191:Vmn1r225	UTSW	17	20502885	missense	probably damaging	0.98
R2206:Vmn1r225	UTSW	17	20502349	missense	possibly damaging	0.56
R2207:Vmn1r225	UTSW	17	20502349	missense	possibly damaging	0.56
R2680:Vmn1r225	UTSW	17	20502793	missense	probably benign	0.00
R3740:Vmn1r225	UTSW	17	20502999	missense	possibly damaging	0.56
R3807:Vmn1r225	UTSW	17	20502852	nonsense	probably null
R4196:Vmn1r225	UTSW	17	20502975	missense	probably benign	0.00
R4970:Vmn1r225	UTSW	17	20502569	missense	possibly damaging	0.74
R5129:Vmn1r225	UTSW	17	20503116	missense	probably damaging	1.00
R5130:Vmn1r225	UTSW	17	20502785	missense	possibly damaging	0.81
R5187:Vmn1r225	UTSW	17	20502915	missense	probably damaging	0.96
R5580:Vmn1r225	UTSW	17	20502839	missense	probably damaging	1.00
R6674:Vmn1r225	UTSW	17	20503115	missense	probably benign	0.06
R7003:Vmn1r225	UTSW	17	20503154	missense	probably null	0.01
R7143:Vmn1r225	UTSW	17	20502384	missense	probably benign	0.22
R7422:Vmn1r225	UTSW	17	20502797	missense	probably benign	0.25
R7651:Vmn1r225	UTSW	17	20502349	missense	possibly damaging	0.56
R7952:Vmn1r225	UTSW	17	20502327	missense	probably damaging	0.98
R8097:Vmn1r225	UTSW	17	20502349	missense	possibly damaging	0.56
R8696:Vmn1r225	UTSW	17	20503157	missense	probably damaging	1.00
R8823:Vmn1r225	UTSW	17	20502561	missense	probably benign	0.08
R9007:Vmn1r225	UTSW	17	20503187	missense	probably damaging	0.96
R9041:Vmn1r225	UTSW	17	20502315	missense	possibly damaging	0.53
R9147:Vmn1r225	UTSW	17	20502315	missense	possibly damaging	0.53
R9148:Vmn1r225	UTSW	17	20502315	missense	possibly damaging	0.53
R9312:Vmn1r225	UTSW	17	20502698	missense	probably benign	0.39
R9401:Vmn1r225	UTSW	17	20502649	nonsense	probably null
R9401:Vmn1r225	UTSW	17	20502650	missense	probably damaging	1.00
R9488:Vmn1r225	UTSW	17	20502531	missense	probably damaging	0.99
Z1177:Vmn1r225	UTSW	17	20502491	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- ATGGAGTCCAGGAACATGGC -3'
(R):5'- ATCCAGCAGAGTAAAATCAAGAGTC -3'

Sequencing Primer
(F):5'- GAACATGGCAATAGGAATCATACTC -3'
(R):5'- GACACTCAAGAGACAGGT -3'

Posted On

2018-06-06