Incidental Mutation 'R6563:Vmn1r225'
ID522581
Institutional Source Beutler Lab
Gene Symbol Vmn1r225
Ensembl Gene ENSMUSG00000043537
Gene Namevomeronasal 1 receptor 225
SynonymsV1re5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20502299-20503195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20502501 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 68 (A68V)
Ref Sequence ENSEMBL: ENSMUSP00000056068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061660]
Predicted Effect probably benign
Transcript: ENSMUST00000061660
AA Change: A68V

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056068
Gene: ENSMUSG00000043537
AA Change: A68V

DomainStartEndE-ValueType
Pfam:TAS2R 1 287 8.9e-15 PFAM
Pfam:V1R 11 291 3.1e-24 PFAM
Meta Mutation Damage Score 0.1829 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Vmn1r225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Vmn1r225 APN 17 20502819 missense probably damaging 1.00
IGL01830:Vmn1r225 APN 17 20502455 missense probably damaging 0.96
IGL02943:Vmn1r225 APN 17 20502305 missense possibly damaging 0.67
R0544:Vmn1r225 UTSW 17 20502456 missense probably benign 0.44
R1126:Vmn1r225 UTSW 17 20502326 missense probably benign 0.03
R1809:Vmn1r225 UTSW 17 20502656 missense probably benign 0.04
R1928:Vmn1r225 UTSW 17 20502809 missense probably benign 0.00
R2044:Vmn1r225 UTSW 17 20502590 missense possibly damaging 0.50
R2191:Vmn1r225 UTSW 17 20502885 missense probably damaging 0.98
R2206:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2207:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2680:Vmn1r225 UTSW 17 20502793 missense probably benign 0.00
R3740:Vmn1r225 UTSW 17 20502999 missense possibly damaging 0.56
R3807:Vmn1r225 UTSW 17 20502852 nonsense probably null
R4196:Vmn1r225 UTSW 17 20502975 missense probably benign 0.00
R4970:Vmn1r225 UTSW 17 20502569 missense possibly damaging 0.74
R5129:Vmn1r225 UTSW 17 20503116 missense probably damaging 1.00
R5130:Vmn1r225 UTSW 17 20502785 missense possibly damaging 0.81
R5187:Vmn1r225 UTSW 17 20502915 missense probably damaging 0.96
R5580:Vmn1r225 UTSW 17 20502839 missense probably damaging 1.00
R6674:Vmn1r225 UTSW 17 20503115 missense probably benign 0.06
R7003:Vmn1r225 UTSW 17 20503154 missense probably null 0.01
R7143:Vmn1r225 UTSW 17 20502384 missense probably benign 0.22
R7422:Vmn1r225 UTSW 17 20502797 missense probably benign 0.25
R7651:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R7952:Vmn1r225 UTSW 17 20502327 missense probably damaging 0.98
R8097:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
Z1177:Vmn1r225 UTSW 17 20502491 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ATGGAGTCCAGGAACATGGC -3'
(R):5'- ATCCAGCAGAGTAAAATCAAGAGTC -3'

Sequencing Primer
(F):5'- GAACATGGCAATAGGAATCATACTC -3'
(R):5'- GACACTCAAGAGACAGGT -3'
Posted On2018-06-06