Incidental Mutation 'R6563:Slk'
ID522589
Institutional Source Beutler Lab
Gene Symbol Slk
Ensembl Gene ENSMUSG00000025060
Gene NameSTE20-like kinase
Synonyms9A2, Stk2, mSLK, Etk4, SLK
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47579678-47645246 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 47636469 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026043] [ENSMUST00000051691]
Predicted Effect probably null
Transcript: ENSMUST00000026043
SMART Domains Protein: ENSMUSP00000026043
Gene: ENSMUSG00000025060

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 849 928 1.2e-19 PFAM
Pfam:PKK 986 1127 7.4e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000051691
SMART Domains Protein: ENSMUSP00000049977
Gene: ENSMUSG00000025060

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 850 988 1.6e-40 PFAM
Pfam:PKK 1018 1158 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147841
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die by E14.5, exhibiting severe developmental defects, impaired neuronal and skeletal muscle development, abnormal placental differentiation and vascularization, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Slk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Slk APN 19 47619709 missense probably benign 0.00
IGL00515:Slk APN 19 47642096 unclassified probably benign
IGL00755:Slk APN 19 47609010 missense probably damaging 0.99
IGL00990:Slk APN 19 47580252 missense probably damaging 0.98
IGL02283:Slk APN 19 47641993 missense probably damaging 1.00
R0140:Slk UTSW 19 47622335 missense probably damaging 1.00
R0364:Slk UTSW 19 47620189 nonsense probably null
R0944:Slk UTSW 19 47608993 missense probably damaging 1.00
R1756:Slk UTSW 19 47622677 missense probably damaging 0.97
R1795:Slk UTSW 19 47620534 missense possibly damaging 0.72
R1869:Slk UTSW 19 47625452 missense probably damaging 1.00
R1980:Slk UTSW 19 47611989 missense probably damaging 1.00
R2261:Slk UTSW 19 47637352 missense probably damaging 0.99
R2278:Slk UTSW 19 47619749 missense probably damaging 0.97
R3746:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3748:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3749:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3750:Slk UTSW 19 47619809 missense possibly damaging 0.88
R4024:Slk UTSW 19 47622370 splice site probably null
R4471:Slk UTSW 19 47615423 missense probably damaging 1.00
R4647:Slk UTSW 19 47620274 missense possibly damaging 0.71
R4825:Slk UTSW 19 47619956 missense probably benign
R5205:Slk UTSW 19 47625460 missense possibly damaging 0.91
R5228:Slk UTSW 19 47625332 missense probably damaging 1.00
R5372:Slk UTSW 19 47625393 missense probably damaging 1.00
R5665:Slk UTSW 19 47636457 missense probably damaging 1.00
R5688:Slk UTSW 19 47620012 missense probably benign 0.00
R5859:Slk UTSW 19 47609042 missense probably benign 0.37
R6279:Slk UTSW 19 47642004 missense probably damaging 1.00
R6368:Slk UTSW 19 47620183 missense possibly damaging 0.85
R6431:Slk UTSW 19 47620888 missense probably damaging 1.00
R6705:Slk UTSW 19 47609059 missense probably benign 0.01
R6790:Slk UTSW 19 47635568 missense probably damaging 0.96
R7495:Slk UTSW 19 47638978 missense probably damaging 1.00
R7598:Slk UTSW 19 47636462 missense probably damaging 1.00
R7728:Slk UTSW 19 47620816 missense probably damaging 1.00
R7850:Slk UTSW 19 47622357 missense probably damaging 1.00
R7860:Slk UTSW 19 47642071 missense possibly damaging 0.65
R7911:Slk UTSW 19 47615229 missense
R8000:Slk UTSW 19 47608905 missense
X0052:Slk UTSW 19 47620933 missense probably benign 0.05
Z1176:Slk UTSW 19 47622276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGGACATTAGTTAAAAGAACCG -3'
(R):5'- TCACAACTGTAATCAGGGAGG -3'

Sequencing Primer
(F):5'- GAACCGAGTGACATTTTGAAAAC -3'
(R):5'- CTGTAATCAGGGAGGAAGATAGGC -3'
Posted On2018-06-06