Incidental Mutation 'R6488:Or5b118'
ID 522590
Institutional Source Beutler Lab
Gene Symbol Or5b118
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor family 5 subfamily B member 118
Synonyms Olfr1474, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527, MOR202-42
MMRRC Submission 044620-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6488 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13448336-13449280 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13448981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 216 (Y216H)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000096202
AA Change: Y216H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: Y216H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207529
Predicted Effect probably damaging
Transcript: ENSMUST00000220113
AA Change: Y216H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,275,298 (GRCm39) Q334* probably null Het
Abhd15 T C 11: 77,406,848 (GRCm39) F275S possibly damaging Het
Adamts7 A G 9: 90,053,535 (GRCm39) T27A probably benign Het
Ankar A G 1: 72,720,967 (GRCm39) probably null Het
Ap2a2 T C 7: 141,182,220 (GRCm39) V183A probably benign Het
Arhgef37 G A 18: 61,651,123 (GRCm39) A134V probably benign Het
Col3a1 C A 1: 45,370,694 (GRCm39) probably benign Het
Cplx3 A G 9: 57,527,926 (GRCm39) S10P possibly damaging Het
Cxcr5 A G 9: 44,425,276 (GRCm39) V127A probably damaging Het
Eif4b T A 15: 102,001,422 (GRCm39) probably benign Het
Ext2 A G 2: 93,636,430 (GRCm39) V228A probably damaging Het
Fam83h T C 15: 75,873,902 (GRCm39) E1145G possibly damaging Het
Fcgbp A G 7: 27,792,963 (GRCm39) D989G probably damaging Het
Fchsd1 T C 18: 38,100,321 (GRCm39) probably null Het
Fcnb T C 2: 27,968,301 (GRCm39) K219E probably damaging Het
Fndc7 T C 3: 108,777,891 (GRCm39) E355G probably damaging Het
Glis3 T C 19: 28,276,253 (GRCm39) H746R probably benign Het
Glod4 A G 11: 76,128,611 (GRCm39) V74A probably damaging Het
Gpc6 T C 14: 118,202,125 (GRCm39) I445T possibly damaging Het
Hdlbp T C 1: 93,355,946 (GRCm39) D337G probably damaging Het
Hnf1a T C 5: 115,094,020 (GRCm39) T190A probably benign Het
Iqgap1 G C 7: 80,380,074 (GRCm39) T1129R probably benign Het
Kcnc3 T C 7: 44,244,606 (GRCm39) F299L possibly damaging Het
Kif26b T C 1: 178,357,138 (GRCm39) V4A unknown Het
Kifbp C A 10: 62,395,437 (GRCm39) probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Krtap4-1 G T 11: 99,518,903 (GRCm39) R36S unknown Het
Lrpprc T C 17: 85,058,781 (GRCm39) N693S probably damaging Het
Lrrc49 A T 9: 60,509,916 (GRCm39) F157L probably damaging Het
Mettl22 T C 16: 8,305,225 (GRCm39) F293L probably damaging Het
Mga T A 2: 119,791,388 (GRCm39) N2424K probably damaging Het
Mgat4f T A 1: 134,318,626 (GRCm39) V466D probably damaging Het
Mpdz G T 4: 81,205,970 (GRCm39) A1784E probably benign Het
Mpv17l G A 16: 13,764,452 (GRCm39) probably null Het
Mtus1 G A 8: 41,494,545 (GRCm39) S29L possibly damaging Het
Myo15a A T 11: 60,369,313 (GRCm39) H691L possibly damaging Het
Nbea T C 3: 55,625,264 (GRCm39) T2276A probably damaging Het
Npas4 A G 19: 5,036,011 (GRCm39) S718P probably damaging Het
Ntrk2 T A 13: 59,009,170 (GRCm39) N320K possibly damaging Het
Nup214 T A 2: 31,881,384 (GRCm39) I414N possibly damaging Het
Oas2 A G 5: 120,876,428 (GRCm39) F15S probably damaging Het
Or52z15 T C 7: 103,332,285 (GRCm39) I110T probably damaging Het
Pabpc6 A G 17: 9,888,528 (GRCm39) Y8H probably damaging Het
Pbx1 T A 1: 168,018,964 (GRCm39) N294Y probably damaging Het
Pcyt1a T C 16: 32,285,899 (GRCm39) M190T probably damaging Het
Pogk T C 1: 166,226,991 (GRCm39) I387V possibly damaging Het
Ppp6r2 T C 15: 89,152,741 (GRCm39) L294P probably benign Het
Pramel51 T C 12: 88,144,357 (GRCm39) H152R possibly damaging Het
Ptprn2 T A 12: 116,835,658 (GRCm39) I331K probably benign Het
Ptpro T G 6: 137,370,673 (GRCm39) Y591* probably null Het
Ptprz1 T A 6: 23,001,516 (GRCm39) L1202* probably null Het
Rab37 A G 11: 115,048,789 (GRCm39) T73A probably benign Het
Rad51ap2 T G 12: 11,508,161 (GRCm39) S694R possibly damaging Het
Rb1cc1 T A 1: 6,340,951 (GRCm39) D148E probably damaging Het
Rraga G A 4: 86,494,565 (GRCm39) R137H probably damaging Het
Serpinf2 A G 11: 75,328,329 (GRCm39) V73A probably benign Het
Siglec1 T C 2: 130,923,227 (GRCm39) N506S probably damaging Het
Slc35e4 T C 11: 3,862,602 (GRCm39) T196A possibly damaging Het
St6galnac3 C T 3: 153,117,394 (GRCm39) A110T probably damaging Het
Thsd1 T C 8: 22,733,733 (GRCm39) V260A probably benign Het
Tpbg T A 9: 85,726,538 (GRCm39) V169D possibly damaging Het
Trav16n A G 14: 53,589,042 (GRCm39) E106G probably benign Het
Vmn1r219 T C 13: 23,347,135 (GRCm39) I108T probably benign Het
Vmn2r50 T C 7: 9,771,644 (GRCm39) I686V probably damaging Het
Zdhhc20 C T 14: 58,078,289 (GRCm39) R329K probably benign Het
Zfp64 A G 2: 168,777,129 (GRCm39) probably null Het
Zfp941 C T 7: 140,392,663 (GRCm39) R232H probably benign Het
Other mutations in Or5b118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Or5b118 APN 19 13,448,631 (GRCm39) missense probably damaging 0.99
D605:Or5b118 UTSW 19 13,448,521 (GRCm39) nonsense probably null
R0173:Or5b118 UTSW 19 13,449,065 (GRCm39) missense probably benign 0.02
R1102:Or5b118 UTSW 19 13,448,771 (GRCm39) missense probably damaging 0.97
R1515:Or5b118 UTSW 19 13,449,044 (GRCm39) missense probably damaging 0.97
R1780:Or5b118 UTSW 19 13,448,726 (GRCm39) missense probably benign 0.14
R2061:Or5b118 UTSW 19 13,448,605 (GRCm39) missense probably damaging 0.98
R4016:Or5b118 UTSW 19 13,448,561 (GRCm39) missense possibly damaging 0.95
R4485:Or5b118 UTSW 19 13,448,919 (GRCm39) missense probably benign 0.08
R5119:Or5b118 UTSW 19 13,448,910 (GRCm39) missense probably benign 0.00
R5150:Or5b118 UTSW 19 13,448,794 (GRCm39) missense probably benign 0.01
R5156:Or5b118 UTSW 19 13,449,037 (GRCm39) missense probably damaging 1.00
R5699:Or5b118 UTSW 19 13,448,336 (GRCm39) start codon destroyed probably null 0.78
R5800:Or5b118 UTSW 19 13,449,260 (GRCm39) missense probably benign 0.06
R5840:Or5b118 UTSW 19 13,449,242 (GRCm39) missense probably benign 0.01
R5953:Or5b118 UTSW 19 13,448,732 (GRCm39) missense possibly damaging 0.92
R5997:Or5b118 UTSW 19 13,448,870 (GRCm39) missense probably benign 0.12
R6233:Or5b118 UTSW 19 13,449,104 (GRCm39) missense probably damaging 1.00
R6847:Or5b118 UTSW 19 13,448,402 (GRCm39) missense probably benign 0.03
R6964:Or5b118 UTSW 19 13,448,725 (GRCm39) nonsense probably null
R7214:Or5b118 UTSW 19 13,448,337 (GRCm39) start codon destroyed probably null 1.00
R8001:Or5b118 UTSW 19 13,448,786 (GRCm39) missense probably benign 0.03
R8035:Or5b118 UTSW 19 13,449,263 (GRCm39) missense probably benign
R8129:Or5b118 UTSW 19 13,448,508 (GRCm39) missense probably damaging 1.00
R9018:Or5b118 UTSW 19 13,448,721 (GRCm39) missense possibly damaging 0.60
R9061:Or5b118 UTSW 19 13,448,523 (GRCm39) missense probably damaging 0.98
R9065:Or5b118 UTSW 19 13,448,670 (GRCm39) missense probably damaging 0.97
R9373:Or5b118 UTSW 19 13,449,216 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCTACACTTGTGGGATC -3'
(R):5'- CACAGGGTTCAGCATAGGAATG -3'

Sequencing Primer
(F):5'- GCTACACTTGTGGGATCTTACAATC -3'
(R):5'- GTTCAGCATAGGAATGACCATTG -3'
Posted On 2018-06-06