Incidental Mutation 'R6565:Cadm3'
ID522593
Institutional Source Beutler Lab
Gene Symbol Cadm3
Ensembl Gene ENSMUSG00000005338
Gene Namecell adhesion molecule 3
SynonymsSynCAM3, Tsll1, Igsf4b, BIgR, Necl-1, Necl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6565 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173333258-173367695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 173341709 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 246 (Q246K)
Ref Sequence ENSEMBL: ENSMUSP00000106851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000111220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005470
AA Change: Q280K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338
AA Change: Q280K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111220
AA Change: Q246K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338
AA Change: Q246K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157032
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-independent cell-cell adhesion protein that can form homodimers or heterodimers with other nectin proteins. The encoded protein has both homophilic and heterophilic cell-cell adhesion activity. This gene is reported to be a tumor suppressor gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed myelination. Other mice with ubiquitous conditional deletion of the gene do not display neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg C A 15: 60,920,810 C96F probably damaging Het
Abca7 C T 10: 80,011,788 P1764L probably damaging Het
Acvr1 G A 2: 58,479,757 T80M probably damaging Het
Adgrb2 T C 4: 130,019,276 L1398P probably damaging Het
B4galnt3 G A 6: 120,217,479 Q362* probably null Het
Cdc14b T C 13: 64,225,630 T110A probably benign Het
Cyp2c55 A C 19: 39,042,122 D466A probably benign Het
Dmrtb1 T C 4: 107,679,345 Y308C probably damaging Het
Fat3 T C 9: 15,915,327 D4443G probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Grin2d A G 7: 45,834,755 L772P probably damaging Het
Gsdme T C 6: 50,229,449 N138S probably damaging Het
Hmgb4 T A 4: 128,260,595 Y60F probably benign Het
Ift172 G A 5: 31,275,883 A554V possibly damaging Het
Iigp1 T A 18: 60,390,767 V319E probably damaging Het
Kit A G 5: 75,645,853 T673A probably damaging Het
Lilra6 A T 7: 3,915,020 W42R probably benign Het
Mia3 A T 1: 183,331,485 H477Q probably damaging Het
Oas1b C A 5: 120,814,546 Q101K possibly damaging Het
Olfr56 A G 11: 49,134,812 M207V probably damaging Het
Olfr586 T C 7: 103,122,238 H178R probably damaging Het
Plcl1 T A 1: 55,697,958 C819* probably null Het
Pmfbp1 C T 8: 109,525,428 Q402* probably null Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Skor2 C G 18: 76,859,912 A443G possibly damaging Het
Tapbpl A G 6: 125,228,344 V213A probably benign Het
Trim52 G A 14: 106,107,219 D104N probably damaging Het
Other mutations in Cadm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Cadm3 APN 1 173341108 missense possibly damaging 0.66
IGL01989:Cadm3 APN 1 173338011 unclassified probably benign
IGL02224:Cadm3 APN 1 173338061 missense possibly damaging 0.51
IGL03105:Cadm3 APN 1 173345016 missense probably damaging 0.96
R0243:Cadm3 UTSW 1 173346573 unclassified probably benign
R0583:Cadm3 UTSW 1 173341171 missense probably benign 0.00
R0689:Cadm3 UTSW 1 173344452 missense possibly damaging 0.95
R2060:Cadm3 UTSW 1 173344402 missense probably damaging 1.00
R2859:Cadm3 UTSW 1 173346545 missense possibly damaging 0.90
R3764:Cadm3 UTSW 1 173346497 missense probably damaging 1.00
R4077:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4079:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4521:Cadm3 UTSW 1 173345063 splice site probably null
R4670:Cadm3 UTSW 1 173346446 missense probably damaging 1.00
R4965:Cadm3 UTSW 1 173337097 missense probably damaging 1.00
R5267:Cadm3 UTSW 1 173337102 missense probably damaging 1.00
R6273:Cadm3 UTSW 1 173349124 unclassified probably benign
R6315:Cadm3 UTSW 1 173344352 missense probably benign 0.16
R6342:Cadm3 UTSW 1 173341108 missense possibly damaging 0.66
R6544:Cadm3 UTSW 1 173367411 critical splice donor site probably null
R7813:Cadm3 UTSW 1 173344389 missense probably benign 0.00
R8024:Cadm3 UTSW 1 173338055 missense probably damaging 0.99
R8078:Cadm3 UTSW 1 173341059 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGAGTGTTCCAACCTCAC -3'
(R):5'- CAAGCTTCTGAGACTTTGGGG -3'

Sequencing Primer
(F):5'- GGAGTGTTCCAACCTCACTTCTG -3'
(R):5'- GATGGGAGATGGAGCCTATAGC -3'
Posted On2018-06-06