Incidental Mutation 'R6489:Arhgef2'
ID522614
Institutional Source Beutler Lab
Gene Symbol Arhgef2
Ensembl Gene ENSMUSG00000028059
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 2
SynonymsP40, Lfc, Lbcl1, GEFH1, LFP40, GEF-H1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R6489 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88605966-88648052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88643014 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 675 (S675R)
Ref Sequence ENSEMBL: ENSMUSP00000134840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029694] [ENSMUST00000107510] [ENSMUST00000170653] [ENSMUST00000175779] [ENSMUST00000175903] [ENSMUST00000175911] [ENSMUST00000176500] [ENSMUST00000176804] [ENSMUST00000177303] [ENSMUST00000177498]
Predicted Effect probably damaging
Transcript: ENSMUST00000029694
AA Change: S692R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029694
Gene: ENSMUSG00000028059
AA Change: S692R

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 240 432 1.86e-58 SMART
PH 474 574 9.56e-11 SMART
coiled coil region 588 619 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
coiled coil region 829 866 N/A INTRINSIC
low complexity region 872 888 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107510
AA Change: S665R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103134
Gene: ENSMUSG00000028059
AA Change: S665R

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 213 405 1.86e-58 SMART
PH 447 547 9.56e-11 SMART
coiled coil region 561 592 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
coiled coil region 802 839 N/A INTRINSIC
low complexity region 845 861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170653
AA Change: S663R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127843
Gene: ENSMUSG00000028059
AA Change: S663R

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175779
AA Change: S677R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135177
Gene: ENSMUSG00000028059
AA Change: S677R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175903
AA Change: S675R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135168
Gene: ENSMUSG00000028059
AA Change: S675R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175911
SMART Domains Protein: ENSMUSP00000135428
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
RhoGEF 232 424 1.86e-58 SMART
PH 466 566 9.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176272
Predicted Effect probably damaging
Transcript: ENSMUST00000176500
AA Change: S677R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134834
Gene: ENSMUSG00000028059
AA Change: S677R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176804
AA Change: S690R

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135397
Gene: ENSMUSG00000028059
AA Change: S690R

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 238 430 1.86e-58 SMART
PH 472 572 9.56e-11 SMART
coiled coil region 586 617 N/A INTRINSIC
low complexity region 810 825 N/A INTRINSIC
coiled coil region 827 864 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177099
Predicted Effect possibly damaging
Transcript: ENSMUST00000177303
AA Change: S663R

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135131
Gene: ENSMUSG00000028059
AA Change: S663R

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177418
Predicted Effect probably damaging
Transcript: ENSMUST00000177498
AA Change: S675R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134840
Gene: ENSMUSG00000028059
AA Change: S675R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.3%
  • 20x: 90.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,010,319 T650A probably benign Het
Alkbh7 T A 17: 56,998,979 S127T probably damaging Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
App G T 16: 85,056,520 D223E unknown Het
Atg14 T C 14: 47,549,023 D258G probably damaging Het
Ckap2l T C 2: 129,269,114 D721G possibly damaging Het
Cog8 T C 8: 107,050,301 T481A probably benign Het
Colec10 C A 15: 54,462,213 probably null Het
Dhx9 T C 1: 153,456,643 probably benign Het
Dock1 T C 7: 134,990,541 M935T probably damaging Het
Dsg4 T A 18: 20,471,363 N962K possibly damaging Het
Dym T C 18: 75,080,226 V173A probably benign Het
Exoc3l4 A G 12: 111,428,697 Y583C probably damaging Het
Fam26e A T 10: 34,092,506 W184R probably damaging Het
Flnb G A 14: 7,867,551 V103M probably damaging Het
Fzd1 T A 5: 4,757,336 Q82L probably benign Het
Gabrr1 A G 4: 33,162,855 I474V probably benign Het
Galnt11 G T 5: 25,264,966 W521L probably damaging Het
Glb1l3 A G 9: 26,826,831 V420A probably benign Het
Gm5678 A T 16: 93,630,398 probably null Het
H1fnt A T 15: 98,257,007 L87* probably null Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Ihh T A 1: 74,946,511 T272S probably damaging Het
Il27ra T C 8: 84,031,550 M524V probably benign Het
Lman1l A T 9: 57,613,726 probably null Het
Mdp1 C A 14: 55,660,391 probably benign Het
Med12l A G 3: 59,257,407 K1436R probably damaging Het
Megf10 C T 18: 57,291,807 S1006F probably benign Het
Miga1 A T 3: 152,279,008 I426N probably damaging Het
Mtmr6 C T 14: 60,300,514 T654I possibly damaging Het
Nbeal1 A G 1: 60,330,942 S2673G possibly damaging Het
Nup93 T A 8: 94,302,088 H193Q probably benign Het
Olfr1303 A C 2: 111,814,060 L222W probably damaging Het
Olfr384 T A 11: 73,603,439 N286K probably damaging Het
Olfr629 T C 7: 103,740,668 N191D probably benign Het
Pdcd11 C T 19: 47,109,752 R826C probably damaging Het
Pde4dip G A 3: 97,755,591 R521* probably null Het
Phf2 T C 13: 48,826,182 S158G unknown Het
Pla2g15 A G 8: 106,163,194 E366G probably benign Het
Plekhm2 A T 4: 141,632,033 H494Q probably damaging Het
Prpsap2 A T 11: 61,749,064 M87K probably damaging Het
Rbm19 T G 5: 120,120,130 S137A probably benign Het
Ryr2 T A 13: 11,834,007 I363L probably benign Het
Samd9l T C 6: 3,376,896 T122A probably benign Het
Scn4a G C 11: 106,349,180 D70E probably benign Het
Slc12a3 T A 8: 94,335,004 V293D possibly damaging Het
Slc6a7 T C 18: 61,007,543 Y139C probably damaging Het
Slco2b1 A T 7: 99,690,555 C9* probably null Het
Slitrk1 A T 14: 108,911,303 S659T possibly damaging Het
Son T G 16: 91,655,156 S264A possibly damaging Het
Svep1 C A 4: 58,100,066 G1326V probably damaging Het
Tcf12 A G 9: 72,015,636 probably null Het
Ttn A G 2: 76,814,718 V11185A probably damaging Het
Ubap2 T C 4: 41,203,574 probably null Het
Utp15 G T 13: 98,250,609 F434L probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vsnl1 T G 12: 11,332,218 probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb34 A C 2: 33,411,546 S328A probably damaging Het
Zdbf2 T C 1: 63,307,478 I1672T possibly damaging Het
Other mutations in Arhgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Arhgef2 APN 3 88631919 missense probably damaging 1.00
IGL02165:Arhgef2 APN 3 88646220 missense probably damaging 1.00
R0090:Arhgef2 UTSW 3 88639348 missense probably damaging 1.00
R0330:Arhgef2 UTSW 3 88642501 missense probably damaging 1.00
R0414:Arhgef2 UTSW 3 88632268 splice site probably benign
R0631:Arhgef2 UTSW 3 88634436 missense probably damaging 0.99
R1635:Arhgef2 UTSW 3 88639321 critical splice acceptor site probably null
R1688:Arhgef2 UTSW 3 88640300 missense probably benign 0.32
R1751:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1767:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1836:Arhgef2 UTSW 3 88639459 missense probably damaging 1.00
R1853:Arhgef2 UTSW 3 88632915 missense possibly damaging 0.48
R1934:Arhgef2 UTSW 3 88629791 missense probably damaging 0.96
R2155:Arhgef2 UTSW 3 88636044 missense probably damaging 1.00
R2206:Arhgef2 UTSW 3 88629914 missense probably damaging 1.00
R2360:Arhgef2 UTSW 3 88634416 missense probably damaging 1.00
R3916:Arhgef2 UTSW 3 88633033 missense probably damaging 1.00
R4090:Arhgef2 UTSW 3 88643878 missense probably benign 0.01
R4732:Arhgef2 UTSW 3 88631940 nonsense probably null
R4733:Arhgef2 UTSW 3 88631940 nonsense probably null
R4837:Arhgef2 UTSW 3 88632943 missense probably damaging 1.00
R4952:Arhgef2 UTSW 3 88642462 missense probably damaging 1.00
R5152:Arhgef2 UTSW 3 88629568 splice site probably null
R5194:Arhgef2 UTSW 3 88635649 missense probably damaging 1.00
R5250:Arhgef2 UTSW 3 88633648 critical splice donor site probably null
R5334:Arhgef2 UTSW 3 88646329 missense probably damaging 0.96
R5514:Arhgef2 UTSW 3 88642997 missense probably benign 0.01
R5560:Arhgef2 UTSW 3 88634437 missense probably damaging 0.97
R5595:Arhgef2 UTSW 3 88642976 missense probably benign 0.00
R5879:Arhgef2 UTSW 3 88643617 splice site probably null
R5910:Arhgef2 UTSW 3 88635020 missense probably damaging 1.00
R5914:Arhgef2 UTSW 3 88635869 missense probably benign
R5918:Arhgef2 UTSW 3 88636080 missense probably damaging 1.00
R6181:Arhgef2 UTSW 3 88635620 missense probably damaging 1.00
R7167:Arhgef2 UTSW 3 88643872 missense possibly damaging 0.56
R7289:Arhgef2 UTSW 3 88635885 missense probably benign
R7318:Arhgef2 UTSW 3 88632303 missense probably damaging 0.98
R7353:Arhgef2 UTSW 3 88635686 missense possibly damaging 0.94
R7402:Arhgef2 UTSW 3 88633566 missense probably damaging 1.00
R7441:Arhgef2 UTSW 3 88643955 missense probably damaging 0.96
V1662:Arhgef2 UTSW 3 88633329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCCTTGGATGCCACATG -3'
(R):5'- CTCTACAGAGTTCAATGGAGCC -3'

Sequencing Primer
(F):5'- CCACATGGCTGACTGAAGC -3'
(R):5'- AGCCATTGAAGGTTCTGGCCTC -3'
Posted On2018-06-06