Incidental Mutation 'R6565:Cdc14b'
ID522633
Institutional Source Beutler Lab
Gene Symbol Cdc14b
Ensembl Gene ENSMUSG00000033102
Gene NameCDC14 cell division cycle 14B
SynonymsA530086E13Rik, 2810432N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R6565 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location64189268-64275290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64225630 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 110 (T110A)
Ref Sequence ENSEMBL: ENSMUSP00000105391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039318] [ENSMUST00000109769] [ENSMUST00000109770] [ENSMUST00000221139] [ENSMUST00000221634]
Predicted Effect probably benign
Transcript: ENSMUST00000039318
AA Change: T147A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046003
Gene: ENSMUSG00000033102
AA Change: T147A

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 6.1e-57 PFAM
Pfam:DSPc 240 365 9.2e-17 PFAM
Pfam:Y_phosphatase 244 365 1e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109769
AA Change: T110A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105391
Gene: ENSMUSG00000033102
AA Change: T110A

DomainStartEndE-ValueType
Pfam:DSPn 12 152 2.5e-58 PFAM
Pfam:DSPc 203 328 8e-17 PFAM
Pfam:Y_phosphatase 206 328 8.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109770
AA Change: T147A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105392
Gene: ENSMUSG00000033102
AA Change: T147A

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 3.4e-57 PFAM
Pfam:DSPc 240 365 2.8e-16 PFAM
Pfam:Y_phosphatase 252 364 2.4e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221139
AA Change: T147A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221437
Predicted Effect probably benign
Transcript: ENSMUST00000221634
AA Change: T147A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. This protein is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, which suggests the role in cell cycle control. This protein has been shown to interact with and dephosphorylates tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splice of this gene results in 3 transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature aging, including premature cataracts and kyphosis; reduced fertility, particularly in female mice; and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg C A 15: 60,920,810 C96F probably damaging Het
Abca7 C T 10: 80,011,788 P1764L probably damaging Het
Acvr1 G A 2: 58,479,757 T80M probably damaging Het
Adgrb2 T C 4: 130,019,276 L1398P probably damaging Het
B4galnt3 G A 6: 120,217,479 Q362* probably null Het
Cadm3 G T 1: 173,341,709 Q246K possibly damaging Het
Cyp2c55 A C 19: 39,042,122 D466A probably benign Het
Dmrtb1 T C 4: 107,679,345 Y308C probably damaging Het
Fat3 T C 9: 15,915,327 D4443G probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Grin2d A G 7: 45,834,755 L772P probably damaging Het
Gsdme T C 6: 50,229,449 N138S probably damaging Het
Hmgb4 T A 4: 128,260,595 Y60F probably benign Het
Ift172 G A 5: 31,275,883 A554V possibly damaging Het
Iigp1 T A 18: 60,390,767 V319E probably damaging Het
Kit A G 5: 75,645,853 T673A probably damaging Het
Lilra6 A T 7: 3,915,020 W42R probably benign Het
Mia3 A T 1: 183,331,485 H477Q probably damaging Het
Oas1b C A 5: 120,814,546 Q101K possibly damaging Het
Olfr56 A G 11: 49,134,812 M207V probably damaging Het
Olfr586 T C 7: 103,122,238 H178R probably damaging Het
Plcl1 T A 1: 55,697,958 C819* probably null Het
Pmfbp1 C T 8: 109,525,428 Q402* probably null Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Skor2 C G 18: 76,859,912 A443G possibly damaging Het
Tapbpl A G 6: 125,228,344 V213A probably benign Het
Trim52 G A 14: 106,107,219 D104N probably damaging Het
Other mutations in Cdc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cdc14b APN 13 64215656 missense probably damaging 1.00
IGL00816:Cdc14b APN 13 64205403 missense probably benign 0.10
IGL02569:Cdc14b APN 13 64225614 missense probably benign 0.36
IGL02634:Cdc14b APN 13 64216303 splice site probably benign
IGL02897:Cdc14b APN 13 64247253 missense probably benign 0.00
R0390:Cdc14b UTSW 13 64210192 unclassified probably benign
R0542:Cdc14b UTSW 13 64243683 missense probably benign 0.01
R1022:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1024:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1676:Cdc14b UTSW 13 64225602 missense possibly damaging 0.93
R1945:Cdc14b UTSW 13 64219890 missense probably damaging 1.00
R1964:Cdc14b UTSW 13 64215537 missense probably damaging 1.00
R3162:Cdc14b UTSW 13 64246608 splice site probably benign
R4359:Cdc14b UTSW 13 64248411 missense probably benign 0.27
R4598:Cdc14b UTSW 13 64247274 missense probably benign
R4716:Cdc14b UTSW 13 64209200 missense probably damaging 1.00
R6196:Cdc14b UTSW 13 64205524 intron probably benign
R6219:Cdc14b UTSW 13 64205524 intron probably benign
R6361:Cdc14b UTSW 13 64216209 splice site probably null
R6480:Cdc14b UTSW 13 64225650 critical splice acceptor site probably null
R6692:Cdc14b UTSW 13 64215563 missense probably damaging 0.98
R7204:Cdc14b UTSW 13 64210198 missense possibly damaging 0.83
R7327:Cdc14b UTSW 13 64225647 missense probably damaging 1.00
R7464:Cdc14b UTSW 13 64196675 nonsense probably null
R7639:Cdc14b UTSW 13 64205329 missense possibly damaging 0.96
R7687:Cdc14b UTSW 13 64209193 missense probably benign 0.15
R8170:Cdc14b UTSW 13 64215735 splice site probably null
Z1176:Cdc14b UTSW 13 64274669 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGTGACAACATTCCAACAGTGTC -3'
(R):5'- TGTGGCAGGGAGAAATCTCTG -3'

Sequencing Primer
(F):5'- CAGTGTCACTGTTAAGACTCTTG -3'
(R):5'- TCTCTGACAGGTTGAGACAAGC -3'
Posted On2018-06-06