Incidental Mutation 'R6489:Pla2g15'
ID522648
Institutional Source Beutler Lab
Gene Symbol Pla2g15
Ensembl Gene ENSMUSG00000031903
Gene Namephospholipase A2, group XV
SynonymsLpla2, LLPL, Lypla3, C87498
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R6489 (G1)
Quality Score176.009
Status Validated
Chromosome8
Chromosomal Location106150399-106164715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106163194 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 366 (E366G)
Ref Sequence ENSEMBL: ENSMUSP00000034377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034377] [ENSMUST00000212963]
Predicted Effect probably benign
Transcript: ENSMUST00000034377
AA Change: E366G

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034377
Gene: ENSMUSG00000031903
AA Change: E366G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LCAT 72 399 6.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212116
Predicted Effect probably benign
Transcript: ENSMUST00000212963
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.3%
  • 20x: 90.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene hydrolyzes lysophosphatidylcholine to glycerophosphorylcholine and a free fatty acid. This enzyme is present in the plasma and thought to be associated with high-density lipoprotein. A later paper contradicts the function of this gene. It demonstrates that this gene encodes a lysosomal enzyme instead of a lysophospholipase and has both calcium-independent phospholipase A2 and transacylase activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice do not develop atherosclerotic lesions even when fed an atherogenic diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,010,319 T650A probably benign Het
Alkbh7 T A 17: 56,998,979 S127T probably damaging Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
App G T 16: 85,056,520 D223E unknown Het
Arhgef2 C A 3: 88,643,014 S675R probably damaging Het
Atg14 T C 14: 47,549,023 D258G probably damaging Het
Ckap2l T C 2: 129,269,114 D721G possibly damaging Het
Cog8 T C 8: 107,050,301 T481A probably benign Het
Colec10 C A 15: 54,462,213 probably null Het
Dhx9 T C 1: 153,456,643 probably benign Het
Dock1 T C 7: 134,990,541 M935T probably damaging Het
Dsg4 T A 18: 20,471,363 N962K possibly damaging Het
Dym T C 18: 75,080,226 V173A probably benign Het
Exoc3l4 A G 12: 111,428,697 Y583C probably damaging Het
Fam26e A T 10: 34,092,506 W184R probably damaging Het
Flnb G A 14: 7,867,551 V103M probably damaging Het
Fzd1 T A 5: 4,757,336 Q82L probably benign Het
Gabrr1 A G 4: 33,162,855 I474V probably benign Het
Galnt11 G T 5: 25,264,966 W521L probably damaging Het
Glb1l3 A G 9: 26,826,831 V420A probably benign Het
Gm5678 A T 16: 93,630,398 probably null Het
H1fnt A T 15: 98,257,007 L87* probably null Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Ihh T A 1: 74,946,511 T272S probably damaging Het
Il27ra T C 8: 84,031,550 M524V probably benign Het
Lman1l A T 9: 57,613,726 probably null Het
Mdp1 C A 14: 55,660,391 probably benign Het
Med12l A G 3: 59,257,407 K1436R probably damaging Het
Megf10 C T 18: 57,291,807 S1006F probably benign Het
Miga1 A T 3: 152,279,008 I426N probably damaging Het
Mtmr6 C T 14: 60,300,514 T654I possibly damaging Het
Nbeal1 A G 1: 60,330,942 S2673G possibly damaging Het
Nup93 T A 8: 94,302,088 H193Q probably benign Het
Olfr1303 A C 2: 111,814,060 L222W probably damaging Het
Olfr384 T A 11: 73,603,439 N286K probably damaging Het
Olfr629 T C 7: 103,740,668 N191D probably benign Het
Pdcd11 C T 19: 47,109,752 R826C probably damaging Het
Pde4dip G A 3: 97,755,591 R521* probably null Het
Phf2 T C 13: 48,826,182 S158G unknown Het
Plekhm2 A T 4: 141,632,033 H494Q probably damaging Het
Prpsap2 A T 11: 61,749,064 M87K probably damaging Het
Rbm19 T G 5: 120,120,130 S137A probably benign Het
Ryr2 T A 13: 11,834,007 I363L probably benign Het
Samd9l T C 6: 3,376,896 T122A probably benign Het
Scn4a G C 11: 106,349,180 D70E probably benign Het
Slc12a3 T A 8: 94,335,004 V293D possibly damaging Het
Slc6a7 T C 18: 61,007,543 Y139C probably damaging Het
Slco2b1 A T 7: 99,690,555 C9* probably null Het
Slitrk1 A T 14: 108,911,303 S659T possibly damaging Het
Son T G 16: 91,655,156 S264A possibly damaging Het
Svep1 C A 4: 58,100,066 G1326V probably damaging Het
Tcf12 A G 9: 72,015,636 probably null Het
Ttn A G 2: 76,814,718 V11185A probably damaging Het
Ubap2 T C 4: 41,203,574 probably null Het
Utp15 G T 13: 98,250,609 F434L probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vsnl1 T G 12: 11,332,218 probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb34 A C 2: 33,411,546 S328A probably damaging Het
Zdbf2 T C 1: 63,307,478 I1672T possibly damaging Het
Other mutations in Pla2g15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pla2g15 APN 8 106163116 missense probably benign 0.00
IGL02719:Pla2g15 APN 8 106160196 missense probably benign 0.01
IGL03065:Pla2g15 APN 8 106160219 missense probably benign 0.20
R0125:Pla2g15 UTSW 8 106163124 missense probably benign 0.00
R1691:Pla2g15 UTSW 8 106154949 missense possibly damaging 0.93
R1939:Pla2g15 UTSW 8 106163295 missense probably damaging 0.96
R3887:Pla2g15 UTSW 8 106161135 missense probably damaging 0.99
R4633:Pla2g15 UTSW 8 106160255 missense probably damaging 1.00
R4702:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4703:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4705:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4766:Pla2g15 UTSW 8 106163071 missense probably damaging 1.00
R4928:Pla2g15 UTSW 8 106163218 nonsense probably null
R5543:Pla2g15 UTSW 8 106161143 missense probably damaging 0.99
R6802:Pla2g15 UTSW 8 106150581 missense probably damaging 0.99
R7381:Pla2g15 UTSW 8 106162944 missense probably benign 0.03
R7961:Pla2g15 UTSW 8 106160284 splice site probably null
Z1177:Pla2g15 UTSW 8 106162987 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAGATGGCTGGTTCATGCGG -3'
(R):5'- CAAGCTTGTAGACCGTGAAAG -3'

Sequencing Primer
(F):5'- TTCATGCGGCAGGACACAG -3'
(R):5'- AAAAGCTCCGTGGTCCAG -3'
Posted On2018-06-06