Mutagenetix > Incidental Mutation

Incidental Mutation 'R6566:Speg'

522651

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e

MMRRC Submission

044690-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6566 (G1)

Quality Score

163.009

Status

Validated

Chromosome

Chromosomal Location

75351941-75408964 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75365107 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 390 (E390V)

Ref Sequence

ENSEMBL: ENSMUSP00000109220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113590] [ENSMUST00000125306] [ENSMUST00000148515]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087122
AA Change: E496V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: E496V

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113590
AA Change: E390V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: E390V

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125118

Predicted Effect

probably benign
Transcript: ENSMUST00000125306

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132100

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132222

Predicted Effect

probably benign
Transcript: ENSMUST00000132228

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: E243V

Predicted Effect

probably benign
Transcript: ENSMUST00000148515

SMART Domains

Protein: ENSMUSP00000116953
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	113	126	N/A	INTRINSIC
low complexity region	137	163	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	204	213	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146705

Meta Mutation Damage Score

0.1265

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	A	G	15: 91,075,321 (GRCm39)	I164T	probably damaging	Het
Adad2	C	T	8: 120,340,971 (GRCm39)	P164S	probably benign	Het
Adcy3	T	A	12: 4,244,324 (GRCm39)	L278H	probably damaging	Het
Aldh16a1	A	C	7: 44,792,651 (GRCm39)	D670E	probably benign	Het
Bcat1	A	G	6: 144,961,210 (GRCm39)	M131T	probably damaging	Het
Dcstamp	T	C	15: 39,617,732 (GRCm39)	F47S	possibly damaging	Het
Dsg1b	T	C	18: 20,530,499 (GRCm39)	F385L	probably damaging	Het
Exoc8	A	C	8: 125,622,783 (GRCm39)	L528R	probably damaging	Het
Fat4	T	C	3: 39,011,275 (GRCm39)	V2125A	possibly damaging	Het
Gm57859	C	T	11: 113,578,824 (GRCm39)	P73L	probably damaging	Het
Hecw1	T	C	13: 14,471,868 (GRCm39)	D600G	probably damaging	Het
Ice2	G	A	9: 69,323,511 (GRCm39)	V669I	probably benign	Het
Khdc4	C	T	3: 88,618,961 (GRCm39)	T555M	probably damaging	Het
Lsr	T	A	7: 30,671,508 (GRCm39)	Y75F	possibly damaging	Het
Mrps30	C	A	13: 118,523,662 (GRCm39)	V37L	probably benign	Het
Myl10	G	C	5: 136,726,825 (GRCm39)	V70L	probably benign	Het
Or6c217	T	A	10: 129,737,947 (GRCm39)	I211L	probably benign	Het
Pign	A	G	1: 105,565,906 (GRCm39)		probably null	Het
Plcd3	A	G	11: 102,964,626 (GRCm39)	Y582H	probably damaging	Het
Rad9b	A	G	5: 122,490,630 (GRCm39)	W29R	probably damaging	Het
Rb1cc1	T	A	1: 6,319,316 (GRCm39)	F912I	probably benign	Het
Rgs16	C	T	1: 153,619,546 (GRCm39)	S184L	unknown	Het
Runx2	A	G	17: 45,125,375 (GRCm39)		probably null	Het
Serpina1f	T	A	12: 103,659,794 (GRCm39)	I163F	probably damaging	Het
Serpina9	T	C	12: 103,963,296 (GRCm39)	E404G	possibly damaging	Het
Slc4a4	T	C	5: 89,297,192 (GRCm39)	S511P	possibly damaging	Het
Syne3	A	G	12: 104,912,966 (GRCm39)	V614A	probably benign	Het
Tmc5	T	C	7: 118,247,067 (GRCm39)	S524P	probably damaging	Het
Tuba4a	G	A	1: 75,193,930 (GRCm39)	T51I	probably damaging	Het
Tymp	T	A	15: 89,257,803 (GRCm39)	T421S	probably benign	Het
Uvssa	A	G	5: 33,549,520 (GRCm39)	R394G	possibly damaging	Het
Wdr7	T	G	18: 63,888,126 (GRCm39)	I533S	possibly damaging	Het
Zbtb5	G	A	4: 44,994,508 (GRCm39)	T292M	probably damaging	Het
Zfp944	T	G	17: 22,558,726 (GRCm39)	K174Q	possibly damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75,387,034 (GRCm39)	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75,387,378 (GRCm39)	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75,386,679 (GRCm39)	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75,364,746 (GRCm39)	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75,404,841 (GRCm39)	missense	probably benign	0.00
IGL01351:Speg	APN	1	75,387,920 (GRCm39)	splice site	probably benign
IGL01473:Speg	APN	1	75,404,929 (GRCm39)	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75,368,541 (GRCm39)	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75,364,471 (GRCm39)	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75,367,734 (GRCm39)	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75,400,031 (GRCm39)	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75,364,831 (GRCm39)	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75,392,241 (GRCm39)	missense	probably benign	0.39
R0112:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75,391,780 (GRCm39)	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75,400,568 (GRCm39)	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75,407,428 (GRCm39)	splice site	probably benign
R0483:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75,404,622 (GRCm39)	missense	probably benign
R0683:Speg	UTSW	1	75,405,762 (GRCm39)	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75,400,133 (GRCm39)	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75,392,036 (GRCm39)	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75,352,318 (GRCm39)	missense	probably benign	0.00
R0866:Speg	UTSW	1	75,393,727 (GRCm39)	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75,381,705 (GRCm39)	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75,391,782 (GRCm39)	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75,405,739 (GRCm39)	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75,403,739 (GRCm39)	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75,378,145 (GRCm39)	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75,399,516 (GRCm39)	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75,407,104 (GRCm39)	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75,405,128 (GRCm39)	splice site	probably benign
R1505:Speg	UTSW	1	75,352,186 (GRCm39)	missense	probably benign	0.02
R1506:Speg	UTSW	1	75,394,307 (GRCm39)	missense	probably benign	0.03
R1531:Speg	UTSW	1	75,377,866 (GRCm39)	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75,398,595 (GRCm39)	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75,404,691 (GRCm39)	missense	probably benign
R1630:Speg	UTSW	1	75,399,621 (GRCm39)	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75,387,193 (GRCm39)	splice site	probably benign
R1673:Speg	UTSW	1	75,387,807 (GRCm39)	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75,398,388 (GRCm39)	missense	possibly damaging	0.87
R1718:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1719:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1759:Speg	UTSW	1	75,377,806 (GRCm39)	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75,365,649 (GRCm39)	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75,400,550 (GRCm39)	missense	probably benign
R1936:Speg	UTSW	1	75,408,052 (GRCm39)	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75,394,371 (GRCm39)	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75,407,121 (GRCm39)	missense	probably benign	0.30
R2287:Speg	UTSW	1	75,407,109 (GRCm39)	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75,383,570 (GRCm39)	missense	probably benign	0.27
R2983:Speg	UTSW	1	75,361,574 (GRCm39)	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3112:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3154:Speg	UTSW	1	75,378,186 (GRCm39)	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75,403,426 (GRCm39)	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75,399,191 (GRCm39)	missense	probably benign	0.27
R4133:Speg	UTSW	1	75,404,548 (GRCm39)	missense	probably benign
R4522:Speg	UTSW	1	75,404,974 (GRCm39)	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75,368,478 (GRCm39)	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75,392,039 (GRCm39)	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75,398,379 (GRCm39)	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75,400,508 (GRCm39)	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75,404,347 (GRCm39)	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75,364,513 (GRCm39)	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75,404,742 (GRCm39)	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75,404,731 (GRCm39)	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75,408,037 (GRCm39)	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75,405,744 (GRCm39)	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75,403,700 (GRCm39)	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75,395,773 (GRCm39)	splice site	probably null
R5985:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75,392,247 (GRCm39)	nonsense	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6143:Speg	UTSW	1	75,391,031 (GRCm39)	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75,383,323 (GRCm39)	nonsense	probably null
R6347:Speg	UTSW	1	75,403,519 (GRCm39)	missense	probably benign	0.00
R6453:Speg	UTSW	1	75,394,616 (GRCm39)	missense	probably benign	0.06
R6505:Speg	UTSW	1	75,406,167 (GRCm39)	missense	possibly damaging	0.93
R6505:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6531:Speg	UTSW	1	75,399,401 (GRCm39)	missense	probably benign	0.03
R6747:Speg	UTSW	1	75,387,039 (GRCm39)	critical splice donor site	probably null
R6819:Speg	UTSW	1	75,368,456 (GRCm39)	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75,394,547 (GRCm39)	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75,364,552 (GRCm39)	nonsense	probably null
R6981:Speg	UTSW	1	75,407,557 (GRCm39)	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75,399,912 (GRCm39)	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75,388,091 (GRCm39)	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75,383,414 (GRCm39)	critical splice donor site	probably null
R7175:Speg	UTSW	1	75,399,134 (GRCm39)	missense	probably benign	0.01
R7178:Speg	UTSW	1	75,399,027 (GRCm39)	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75,361,479 (GRCm39)	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75,407,549 (GRCm39)	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75,378,108 (GRCm39)	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75,405,886 (GRCm39)	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75,382,959 (GRCm39)	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75,377,834 (GRCm39)	missense	probably benign	0.04
R7696:Speg	UTSW	1	75,405,805 (GRCm39)	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75,352,469 (GRCm39)	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75,365,514 (GRCm39)	missense	probably benign	0.00
R7824:Speg	UTSW	1	75,360,661 (GRCm39)	splice site	probably null
R7834:Speg	UTSW	1	75,361,571 (GRCm39)	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75,403,810 (GRCm39)	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75,392,065 (GRCm39)	splice site	probably benign
R8068:Speg	UTSW	1	75,398,894 (GRCm39)	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75,391,997 (GRCm39)	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75,392,240 (GRCm39)	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75,399,639 (GRCm39)	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75,395,677 (GRCm39)	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75,398,880 (GRCm39)	missense	probably benign	0.26
R8299:Speg	UTSW	1	75,364,480 (GRCm39)	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75,387,976 (GRCm39)	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75,407,953 (GRCm39)	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75,378,908 (GRCm39)	splice site	probably null
R8781:Speg	UTSW	1	75,383,665 (GRCm39)	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75,381,793 (GRCm39)	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75,404,082 (GRCm39)	critical splice donor site	probably null
R8881:Speg	UTSW	1	75,377,795 (GRCm39)	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75,365,517 (GRCm39)	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75,399,250 (GRCm39)	missense	probably benign	0.30
R9019:Speg	UTSW	1	75,405,882 (GRCm39)	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75,365,076 (GRCm39)	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75,361,654 (GRCm39)	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75,399,378 (GRCm39)	missense	probably benign	0.01
R9117:Speg	UTSW	1	75,364,444 (GRCm39)	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75,367,637 (GRCm39)	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75,361,498 (GRCm39)	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75,398,420 (GRCm39)	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75,394,377 (GRCm39)	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75,399,152 (GRCm39)	missense	probably benign
R9475:Speg	UTSW	1	75,364,735 (GRCm39)	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75,392,380 (GRCm39)	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75,364,447 (GRCm39)	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75,399,426 (GRCm39)	missense	probably benign	0.08
R9553:Speg	UTSW	1	75,394,645 (GRCm39)	missense	probably benign	0.00
R9767:Speg	UTSW	1	75,403,825 (GRCm39)	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75,395,617 (GRCm39)	nonsense	probably null
R9800:Speg	UTSW	1	75,399,358 (GRCm39)	missense	probably benign	0.03
X0025:Speg	UTSW	1	75,399,101 (GRCm39)	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75,400,119 (GRCm39)	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75,383,238 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,404,327 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,407,099 (GRCm39)	missense	probably damaging	0.99
Z1177:Speg	UTSW	1	75,405,025 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATCCTGGACAAGCTACAGTTC -3'
(R):5'- AGATTTGCCCGCACCACTAG -3'

Sequencing Primer
(F):5'- CTGGACAAGCTACAGTTCTTCGAAG -3'
(R):5'- CCGCACCACTAGGAGGC -3'

Posted On

2018-06-06