Mutagenetix > Incidental Mutation

Incidental Mutation 'R6489:Lman1l'

522654

Institutional Source

Beutler Lab

Gene Symbol

Lman1l

Ensembl Gene

ENSMUSG00000056271

Gene Name

lectin, mannose-binding 1 like

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6489 (G1)

Quality Score

222.009

Status

Validated

Chromosome

Chromosomal Location

57607085-57620774 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 57613726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044937] [ENSMUST00000093832] [ENSMUST00000093832]

AlphaFold

Q8VCD3

Predicted Effect

probably benign
Transcript: ENSMUST00000044937

SMART Domains

Protein: ENSMUSP00000041631
Gene: ENSMUSG00000056271

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Lectin_leg-like	32	256	1.2e-53	PFAM
low complexity region	272	287	N/A	INTRINSIC
coiled coil region	316	337	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000093832

SMART Domains

Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Lectin_leg-like	32	256	2.7e-53	PFAM
low complexity region	272	287	N/A	INTRINSIC
coiled coil region	316	337	N/A	INTRINSIC
transmembrane domain	439	461	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000093832

SMART Domains

Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Lectin_leg-like	32	256	2.7e-53	PFAM
low complexity region	272	287	N/A	INTRINSIC
coiled coil region	316	337	N/A	INTRINSIC
transmembrane domain	439	461	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.3%
20x: 90.6%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannose-binding type 1 transmembrane protein that contains an N-terminal lectin-like carbohydrate recognition domain. The encoded protein is similar in structure to lectins found in leguminous plants. This lectin is thought to transport newly synthesized glycoproteins from the endoplasmic reticulum (ER) to the ER-Golgi intermediate compartment. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,010,319	T650A	probably benign	Het
Alkbh7	T	A	17: 56,998,979	S127T	probably damaging	Het
Ank3	G	A	10: 69,991,629	A565T	probably benign	Het
App	G	T	16: 85,056,520	D223E	unknown	Het
Arhgef2	C	A	3: 88,643,014	S675R	probably damaging	Het
Atg14	T	C	14: 47,549,023	D258G	probably damaging	Het
Ckap2l	T	C	2: 129,269,114	D721G	possibly damaging	Het
Cog8	T	C	8: 107,050,301	T481A	probably benign	Het
Colec10	C	A	15: 54,462,213		probably null	Het
Dhx9	T	C	1: 153,456,643		probably benign	Het
Dock1	T	C	7: 134,990,541	M935T	probably damaging	Het
Dsg4	T	A	18: 20,471,363	N962K	possibly damaging	Het
Dym	T	C	18: 75,080,226	V173A	probably benign	Het
Exoc3l4	A	G	12: 111,428,697	Y583C	probably damaging	Het
Fam26e	A	T	10: 34,092,506	W184R	probably damaging	Het
Flnb	G	A	14: 7,867,551	V103M	probably damaging	Het
Fzd1	T	A	5: 4,757,336	Q82L	probably benign	Het
Gabrr1	A	G	4: 33,162,855	I474V	probably benign	Het
Galnt11	G	T	5: 25,264,966	W521L	probably damaging	Het
Glb1l3	A	G	9: 26,826,831	V420A	probably benign	Het
Gm5678	A	T	16: 93,630,398		probably null	Het
H1fnt	A	T	15: 98,257,007	L87*	probably null	Het
Homer2	T	C	7: 81,624,278	T57A	probably benign	Het
Ihh	T	A	1: 74,946,511	T272S	probably damaging	Het
Il27ra	T	C	8: 84,031,550	M524V	probably benign	Het
Mdp1	C	A	14: 55,660,391		probably benign	Het
Med12l	A	G	3: 59,257,407	K1436R	probably damaging	Het
Megf10	C	T	18: 57,291,807	S1006F	probably benign	Het
Miga1	A	T	3: 152,279,008	I426N	probably damaging	Het
Mtmr6	C	T	14: 60,300,514	T654I	possibly damaging	Het
Nbeal1	A	G	1: 60,330,942	S2673G	possibly damaging	Het
Nup93	T	A	8: 94,302,088	H193Q	probably benign	Het
Olfr1303	A	C	2: 111,814,060	L222W	probably damaging	Het
Olfr384	T	A	11: 73,603,439	N286K	probably damaging	Het
Olfr629	T	C	7: 103,740,668	N191D	probably benign	Het
Pdcd11	C	T	19: 47,109,752	R826C	probably damaging	Het
Pde4dip	G	A	3: 97,755,591	R521*	probably null	Het
Phf2	T	C	13: 48,826,182	S158G	unknown	Het
Pla2g15	A	G	8: 106,163,194	E366G	probably benign	Het
Plekhm2	A	T	4: 141,632,033	H494Q	probably damaging	Het
Prpsap2	A	T	11: 61,749,064	M87K	probably damaging	Het
Rbm19	T	G	5: 120,120,130	S137A	probably benign	Het
Ryr2	T	A	13: 11,834,007	I363L	probably benign	Het
Samd9l	T	C	6: 3,376,896	T122A	probably benign	Het
Scn4a	G	C	11: 106,349,180	D70E	probably benign	Het
Slc12a3	T	A	8: 94,335,004	V293D	possibly damaging	Het
Slc6a7	T	C	18: 61,007,543	Y139C	probably damaging	Het
Slco2b1	A	T	7: 99,690,555	C9*	probably null	Het
Slitrk1	A	T	14: 108,911,303	S659T	possibly damaging	Het
Son	T	G	16: 91,655,156	S264A	possibly damaging	Het
Svep1	C	A	4: 58,100,066	G1326V	probably damaging	Het
Tcf12	A	G	9: 72,015,636		probably null	Het
Ttn	A	G	2: 76,814,718	V11185A	probably damaging	Het
Ubap2	T	C	4: 41,203,574		probably null	Het
Utp15	G	T	13: 98,250,609	F434L	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vsnl1	T	G	12: 11,332,218		probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zbtb34	A	C	2: 33,411,546	S328A	probably damaging	Het
Zdbf2	T	C	1: 63,307,478	I1672T	possibly damaging	Het

Other mutations in Lman1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01784:Lman1l	APN	9	57620564	missense	probably damaging	1.00
IGL03164:Lman1l	APN	9	57609995	missense	probably damaging	0.99
IGL03226:Lman1l	APN	9	57610007	missense	probably benign	0.43
PIT4283001:Lman1l	UTSW	9	57616076	missense	probably damaging	1.00
R0555:Lman1l	UTSW	9	57614101	missense	probably benign	0.15
R1168:Lman1l	UTSW	9	57608312	missense	probably benign	0.00
R1169:Lman1l	UTSW	9	57609995	missense	probably damaging	0.99
R1591:Lman1l	UTSW	9	57615802	missense	probably benign	0.30
R2289:Lman1l	UTSW	9	57613658	missense	possibly damaging	0.76
R3848:Lman1l	UTSW	9	57608317	missense	possibly damaging	0.48
R4685:Lman1l	UTSW	9	57609200	missense	probably damaging	0.98
R5170:Lman1l	UTSW	9	57615619	nonsense	probably null
R5309:Lman1l	UTSW	9	57611077	missense	probably damaging	0.98
R5312:Lman1l	UTSW	9	57611077	missense	probably damaging	0.98
R5639:Lman1l	UTSW	9	57611866	missense	probably benign	0.24
R5655:Lman1l	UTSW	9	57615975	missense	probably damaging	1.00
R5905:Lman1l	UTSW	9	57608263	missense	probably damaging	1.00
R6011:Lman1l	UTSW	9	57615755	missense	probably damaging	1.00
R6028:Lman1l	UTSW	9	57608263	missense	probably damaging	1.00
R6035:Lman1l	UTSW	9	57611747	critical splice donor site	probably null
R6035:Lman1l	UTSW	9	57611747	critical splice donor site	probably null
R6250:Lman1l	UTSW	9	57615624	missense	probably benign	0.00
R6488:Lman1l	UTSW	9	57620643	missense	possibly damaging	0.73
R6720:Lman1l	UTSW	9	57614072	splice site	probably null
R7000:Lman1l	UTSW	9	57615948	missense	probably benign	0.27
R7139:Lman1l	UTSW	9	57615596	missense	probably benign	0.37
R8822:Lman1l	UTSW	9	57607188	missense	probably benign	0.00
R9800:Lman1l	UTSW	9	57615777	missense	probably damaging	0.99
X0057:Lman1l	UTSW	9	57615957	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACCTTAGAAGCTGCAACCAGG -3'
(R):5'- AGTACCCACACGTGATCTCC -3'

Sequencing Primer
(F):5'- AGCTGCAACCAGGTCTTG -3'
(R):5'- CGTGATCTCCCACCAATACAAAG -3'

Posted On

2018-06-06