Incidental Mutation 'R6489:Lman1l'
ID 522654
Institutional Source Beutler Lab
Gene Symbol Lman1l
Ensembl Gene ENSMUSG00000056271
Gene Name lectin, mannose-binding 1 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6489 (G1)
Quality Score 222.009
Status Validated
Chromosome 9
Chromosomal Location 57607085-57620774 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 57613726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044937] [ENSMUST00000093832] [ENSMUST00000093832]
AlphaFold Q8VCD3
Predicted Effect probably benign
Transcript: ENSMUST00000044937
SMART Domains Protein: ENSMUSP00000041631
Gene: ENSMUSG00000056271

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 1.2e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093832
SMART Domains Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 2.7e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
transmembrane domain 439 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093832
SMART Domains Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 2.7e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
transmembrane domain 439 461 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.3%
  • 20x: 90.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannose-binding type 1 transmembrane protein that contains an N-terminal lectin-like carbohydrate recognition domain. The encoded protein is similar in structure to lectins found in leguminous plants. This lectin is thought to transport newly synthesized glycoproteins from the endoplasmic reticulum (ER) to the ER-Golgi intermediate compartment. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,010,319 T650A probably benign Het
Alkbh7 T A 17: 56,998,979 S127T probably damaging Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
App G T 16: 85,056,520 D223E unknown Het
Arhgef2 C A 3: 88,643,014 S675R probably damaging Het
Atg14 T C 14: 47,549,023 D258G probably damaging Het
Ckap2l T C 2: 129,269,114 D721G possibly damaging Het
Cog8 T C 8: 107,050,301 T481A probably benign Het
Colec10 C A 15: 54,462,213 probably null Het
Dhx9 T C 1: 153,456,643 probably benign Het
Dock1 T C 7: 134,990,541 M935T probably damaging Het
Dsg4 T A 18: 20,471,363 N962K possibly damaging Het
Dym T C 18: 75,080,226 V173A probably benign Het
Exoc3l4 A G 12: 111,428,697 Y583C probably damaging Het
Fam26e A T 10: 34,092,506 W184R probably damaging Het
Flnb G A 14: 7,867,551 V103M probably damaging Het
Fzd1 T A 5: 4,757,336 Q82L probably benign Het
Gabrr1 A G 4: 33,162,855 I474V probably benign Het
Galnt11 G T 5: 25,264,966 W521L probably damaging Het
Glb1l3 A G 9: 26,826,831 V420A probably benign Het
Gm5678 A T 16: 93,630,398 probably null Het
H1fnt A T 15: 98,257,007 L87* probably null Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Ihh T A 1: 74,946,511 T272S probably damaging Het
Il27ra T C 8: 84,031,550 M524V probably benign Het
Mdp1 C A 14: 55,660,391 probably benign Het
Med12l A G 3: 59,257,407 K1436R probably damaging Het
Megf10 C T 18: 57,291,807 S1006F probably benign Het
Miga1 A T 3: 152,279,008 I426N probably damaging Het
Mtmr6 C T 14: 60,300,514 T654I possibly damaging Het
Nbeal1 A G 1: 60,330,942 S2673G possibly damaging Het
Nup93 T A 8: 94,302,088 H193Q probably benign Het
Olfr1303 A C 2: 111,814,060 L222W probably damaging Het
Olfr384 T A 11: 73,603,439 N286K probably damaging Het
Olfr629 T C 7: 103,740,668 N191D probably benign Het
Pdcd11 C T 19: 47,109,752 R826C probably damaging Het
Pde4dip G A 3: 97,755,591 R521* probably null Het
Phf2 T C 13: 48,826,182 S158G unknown Het
Pla2g15 A G 8: 106,163,194 E366G probably benign Het
Plekhm2 A T 4: 141,632,033 H494Q probably damaging Het
Prpsap2 A T 11: 61,749,064 M87K probably damaging Het
Rbm19 T G 5: 120,120,130 S137A probably benign Het
Ryr2 T A 13: 11,834,007 I363L probably benign Het
Samd9l T C 6: 3,376,896 T122A probably benign Het
Scn4a G C 11: 106,349,180 D70E probably benign Het
Slc12a3 T A 8: 94,335,004 V293D possibly damaging Het
Slc6a7 T C 18: 61,007,543 Y139C probably damaging Het
Slco2b1 A T 7: 99,690,555 C9* probably null Het
Slitrk1 A T 14: 108,911,303 S659T possibly damaging Het
Son T G 16: 91,655,156 S264A possibly damaging Het
Svep1 C A 4: 58,100,066 G1326V probably damaging Het
Tcf12 A G 9: 72,015,636 probably null Het
Ttn A G 2: 76,814,718 V11185A probably damaging Het
Ubap2 T C 4: 41,203,574 probably null Het
Utp15 G T 13: 98,250,609 F434L probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vsnl1 T G 12: 11,332,218 probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb34 A C 2: 33,411,546 S328A probably damaging Het
Zdbf2 T C 1: 63,307,478 I1672T possibly damaging Het
Other mutations in Lman1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Lman1l APN 9 57620564 missense probably damaging 1.00
IGL03164:Lman1l APN 9 57609995 missense probably damaging 0.99
IGL03226:Lman1l APN 9 57610007 missense probably benign 0.43
PIT4283001:Lman1l UTSW 9 57616076 missense probably damaging 1.00
R0555:Lman1l UTSW 9 57614101 missense probably benign 0.15
R1168:Lman1l UTSW 9 57608312 missense probably benign 0.00
R1169:Lman1l UTSW 9 57609995 missense probably damaging 0.99
R1591:Lman1l UTSW 9 57615802 missense probably benign 0.30
R2289:Lman1l UTSW 9 57613658 missense possibly damaging 0.76
R3848:Lman1l UTSW 9 57608317 missense possibly damaging 0.48
R4685:Lman1l UTSW 9 57609200 missense probably damaging 0.98
R5170:Lman1l UTSW 9 57615619 nonsense probably null
R5309:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5312:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5639:Lman1l UTSW 9 57611866 missense probably benign 0.24
R5655:Lman1l UTSW 9 57615975 missense probably damaging 1.00
R5905:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6011:Lman1l UTSW 9 57615755 missense probably damaging 1.00
R6028:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6035:Lman1l UTSW 9 57611747 critical splice donor site probably null
R6035:Lman1l UTSW 9 57611747 critical splice donor site probably null
R6250:Lman1l UTSW 9 57615624 missense probably benign 0.00
R6488:Lman1l UTSW 9 57620643 missense possibly damaging 0.73
R6720:Lman1l UTSW 9 57614072 splice site probably null
R7000:Lman1l UTSW 9 57615948 missense probably benign 0.27
R7139:Lman1l UTSW 9 57615596 missense probably benign 0.37
R8822:Lman1l UTSW 9 57607188 missense probably benign 0.00
R9800:Lman1l UTSW 9 57615777 missense probably damaging 0.99
X0057:Lman1l UTSW 9 57615957 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTAGAAGCTGCAACCAGG -3'
(R):5'- AGTACCCACACGTGATCTCC -3'

Sequencing Primer
(F):5'- AGCTGCAACCAGGTCTTG -3'
(R):5'- CGTGATCTCCCACCAATACAAAG -3'
Posted On 2018-06-06