Incidental Mutation 'R6566:2810403A07Rik'
ID522659
Institutional Source Beutler Lab
Gene Symbol 2810403A07Rik
Ensembl Gene ENSMUSG00000028060
Gene NameRIKEN cDNA 2810403A07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R6566 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88685803-88712924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88711654 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 555 (T555M)
Ref Sequence ENSEMBL: ENSMUSP00000029696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029696] [ENSMUST00000198042] [ENSMUST00000198078] [ENSMUST00000199684]
Predicted Effect probably damaging
Transcript: ENSMUST00000029696
AA Change: T555M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029696
Gene: ENSMUSG00000028060
AA Change: T555M

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 2e-28 BLAST
PDB:2YQR|A 229 340 6e-76 PDB
Blast:KH 233 319 1e-36 BLAST
SCOP:d1k1ga_ 233 327 4e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 566 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197300
Predicted Effect probably benign
Transcript: ENSMUST00000198042
SMART Domains Protein: ENSMUSP00000142773
Gene: ENSMUSG00000028060

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198078
SMART Domains Protein: ENSMUSP00000142760
Gene: ENSMUSG00000028060

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 5e-29 BLAST
PDB:2YQR|A 229 340 1e-77 PDB
Blast:KH 233 319 3e-37 BLAST
SCOP:d1k1ga_ 233 327 4e-17 SMART
low complexity region 410 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198721
Predicted Effect probably benign
Transcript: ENSMUST00000199684
SMART Domains Protein: ENSMUSP00000142353
Gene: ENSMUSG00000028060

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,191,118 I164T probably damaging Het
Adad2 C T 8: 119,614,232 P164S probably benign Het
Adcy3 T A 12: 4,194,324 L278H probably damaging Het
Aldh16a1 A C 7: 45,143,227 D670E probably benign Het
Bcat1 A G 6: 145,015,484 M131T probably damaging Het
D11Wsu47e C T 11: 113,687,998 P73L probably damaging Het
Dcstamp T C 15: 39,754,336 F47S possibly damaging Het
Dsg1b T C 18: 20,397,442 F385L probably damaging Het
Exoc8 A C 8: 124,896,044 L528R probably damaging Het
Fat4 T C 3: 38,957,126 V2125A possibly damaging Het
Hecw1 T C 13: 14,297,283 D600G probably damaging Het
Ice2 G A 9: 69,416,229 V669I probably benign Het
Lsr T A 7: 30,972,083 Y75F possibly damaging Het
Mrps30 C A 13: 118,387,126 V37L probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr815 T A 10: 129,902,078 I211L probably benign Het
Pign A G 1: 105,638,181 probably null Het
Plcd3 A G 11: 103,073,800 Y582H probably damaging Het
Rad9b A G 5: 122,352,567 W29R probably damaging Het
Rb1cc1 T A 1: 6,249,092 F912I probably benign Het
Rgs16 C T 1: 153,743,800 S184L unknown Het
Runx2 A G 17: 44,814,488 probably null Het
Serpina1f T A 12: 103,693,535 I163F probably damaging Het
Serpina9 T C 12: 103,997,037 E404G possibly damaging Het
Slc4a4 T C 5: 89,149,333 S511P possibly damaging Het
Speg A T 1: 75,388,463 E390V probably damaging Het
Syne3 A G 12: 104,946,707 V614A probably benign Het
Tmc5 T C 7: 118,647,844 S524P probably damaging Het
Tuba4a G A 1: 75,217,286 T51I probably damaging Het
Tymp T A 15: 89,373,600 T421S probably benign Het
Uvssa A G 5: 33,392,176 R394G possibly damaging Het
Wdr7 T G 18: 63,755,055 I533S possibly damaging Het
Zbtb5 G A 4: 44,994,508 T292M probably damaging Het
Zfp944 T G 17: 22,339,745 K174Q possibly damaging Het
Other mutations in 2810403A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0085:2810403A07Rik UTSW 3 88711739 missense probably damaging 0.99
R0271:2810403A07Rik UTSW 3 88686329 splice site probably benign
R1160:2810403A07Rik UTSW 3 88708862 missense probably damaging 0.99
R2348:2810403A07Rik UTSW 3 88708876 missense probably benign 0.01
R3121:2810403A07Rik UTSW 3 88689292 missense probably damaging 1.00
R3546:2810403A07Rik UTSW 3 88693136 splice site probably benign
R3548:2810403A07Rik UTSW 3 88693136 splice site probably benign
R4688:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R5249:2810403A07Rik UTSW 3 88696725 missense probably damaging 1.00
R5393:2810403A07Rik UTSW 3 88696606 missense probably benign 0.08
R5558:2810403A07Rik UTSW 3 88693096 missense probably damaging 0.98
R5579:2810403A07Rik UTSW 3 88700275 missense probably benign
R5782:2810403A07Rik UTSW 3 88711678 missense probably damaging 0.96
R5809:2810403A07Rik UTSW 3 88708885 missense probably damaging 0.96
R6415:2810403A07Rik UTSW 3 88699972 missense probably benign 0.25
R6765:2810403A07Rik UTSW 3 88686429 missense probably damaging 1.00
R6939:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R7248:2810403A07Rik UTSW 3 88693579 missense probably damaging 1.00
R7311:2810403A07Rik UTSW 3 88711695 missense probably damaging 0.96
R7852:2810403A07Rik UTSW 3 88696736 missense probably benign 0.06
R7935:2810403A07Rik UTSW 3 88696736 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCATCAACGTTATGGGGTGAC -3'
(R):5'- CAGAACAGGTCCCAGAGTCTTG -3'

Sequencing Primer
(F):5'- CCATTGACCCTGTGGCTACAAAATG -3'
(R):5'- TCACTGAGGGTCAAAGCTCTGTC -3'
Posted On2018-06-06