Incidental Mutation 'R6566:Aldh16a1'
ID 522675
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Name aldehyde dehydrogenase 16 family, member A1
Synonyms 2410004H02Rik
MMRRC Submission 044690-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6566 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44791257-44804008 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 44792651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 670 (D670E)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107815
AA Change: D670E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: D670E

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably benign
Transcript: ENSMUST00000209963
AA Change: D670E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,075,321 (GRCm39) I164T probably damaging Het
Adad2 C T 8: 120,340,971 (GRCm39) P164S probably benign Het
Adcy3 T A 12: 4,244,324 (GRCm39) L278H probably damaging Het
Bcat1 A G 6: 144,961,210 (GRCm39) M131T probably damaging Het
Dcstamp T C 15: 39,617,732 (GRCm39) F47S possibly damaging Het
Dsg1b T C 18: 20,530,499 (GRCm39) F385L probably damaging Het
Exoc8 A C 8: 125,622,783 (GRCm39) L528R probably damaging Het
Fat4 T C 3: 39,011,275 (GRCm39) V2125A possibly damaging Het
Gm57859 C T 11: 113,578,824 (GRCm39) P73L probably damaging Het
Hecw1 T C 13: 14,471,868 (GRCm39) D600G probably damaging Het
Ice2 G A 9: 69,323,511 (GRCm39) V669I probably benign Het
Khdc4 C T 3: 88,618,961 (GRCm39) T555M probably damaging Het
Lsr T A 7: 30,671,508 (GRCm39) Y75F possibly damaging Het
Mrps30 C A 13: 118,523,662 (GRCm39) V37L probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Or6c217 T A 10: 129,737,947 (GRCm39) I211L probably benign Het
Pign A G 1: 105,565,906 (GRCm39) probably null Het
Plcd3 A G 11: 102,964,626 (GRCm39) Y582H probably damaging Het
Rad9b A G 5: 122,490,630 (GRCm39) W29R probably damaging Het
Rb1cc1 T A 1: 6,319,316 (GRCm39) F912I probably benign Het
Rgs16 C T 1: 153,619,546 (GRCm39) S184L unknown Het
Runx2 A G 17: 45,125,375 (GRCm39) probably null Het
Serpina1f T A 12: 103,659,794 (GRCm39) I163F probably damaging Het
Serpina9 T C 12: 103,963,296 (GRCm39) E404G possibly damaging Het
Slc4a4 T C 5: 89,297,192 (GRCm39) S511P possibly damaging Het
Speg A T 1: 75,365,107 (GRCm39) E390V probably damaging Het
Syne3 A G 12: 104,912,966 (GRCm39) V614A probably benign Het
Tmc5 T C 7: 118,247,067 (GRCm39) S524P probably damaging Het
Tuba4a G A 1: 75,193,930 (GRCm39) T51I probably damaging Het
Tymp T A 15: 89,257,803 (GRCm39) T421S probably benign Het
Uvssa A G 5: 33,549,520 (GRCm39) R394G possibly damaging Het
Wdr7 T G 18: 63,888,126 (GRCm39) I533S possibly damaging Het
Zbtb5 G A 4: 44,994,508 (GRCm39) T292M probably damaging Het
Zfp944 T G 17: 22,558,726 (GRCm39) K174Q possibly damaging Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 44,794,937 (GRCm39) missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 44,791,391 (GRCm39) missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 44,791,517 (GRCm39) missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 44,795,018 (GRCm39) missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 44,791,399 (GRCm39) missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 44,797,403 (GRCm39) missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 44,792,262 (GRCm39) missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 44,795,653 (GRCm39) splice site probably null
R0707:Aldh16a1 UTSW 7 44,793,931 (GRCm39) unclassified probably benign
R0801:Aldh16a1 UTSW 7 44,796,900 (GRCm39) missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 44,791,471 (GRCm39) splice site probably null
R1371:Aldh16a1 UTSW 7 44,796,674 (GRCm39) missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 44,796,732 (GRCm39) missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 44,796,585 (GRCm39) critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 44,798,212 (GRCm39) intron probably benign
R4859:Aldh16a1 UTSW 7 44,796,731 (GRCm39) missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 44,791,493 (GRCm39) missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 44,794,076 (GRCm39) missense probably null 0.82
R5647:Aldh16a1 UTSW 7 44,803,889 (GRCm39) missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 44,797,223 (GRCm39) missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 44,803,831 (GRCm39) unclassified probably benign
R5879:Aldh16a1 UTSW 7 44,796,930 (GRCm39) nonsense probably null
R5890:Aldh16a1 UTSW 7 44,793,969 (GRCm39) missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 44,799,189 (GRCm39) missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 44,795,695 (GRCm39) missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 44,794,361 (GRCm39) missense possibly damaging 0.93
R7248:Aldh16a1 UTSW 7 44,795,018 (GRCm39) missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 44,797,328 (GRCm39) missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 44,795,331 (GRCm39) missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 44,796,955 (GRCm39) missense unknown
R7830:Aldh16a1 UTSW 7 44,795,649 (GRCm39) missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 44,799,115 (GRCm39) missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 44,791,438 (GRCm39) missense probably benign
R9011:Aldh16a1 UTSW 7 44,794,951 (GRCm39) missense probably damaging 0.98
R9187:Aldh16a1 UTSW 7 44,791,441 (GRCm39) missense probably damaging 0.99
R9620:Aldh16a1 UTSW 7 44,797,413 (GRCm39) nonsense probably null
Z1177:Aldh16a1 UTSW 7 44,795,327 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGTTATCATAGCTACCCAGG -3'
(R):5'- TCCCCTGGTTACACATTATGGAG -3'

Sequencing Primer
(F):5'- GGAGGAGGCCAGCTGAGC -3'
(R):5'- CACATTATGGAGCTACTCTGGAGC -3'
Posted On 2018-06-06