Mutagenetix > Incidental Mutation

Incidental Mutation 'R6566:Aldh16a1'

522675

Institutional Source

Beutler Lab

Gene Symbol

Aldh16a1

Ensembl Gene

ENSMUSG00000007833

Gene Name

aldehyde dehydrogenase 16 family, member A1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6566 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45140684-45154584 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 45143227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 670 (D670E)

Ref Sequence

ENSEMBL: ENSMUSP00000148069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000107815
AA Change: D670E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: D670E

Domain	Start	End	E-Value	Type
Pfam:Aldedh	48	488	3.8e-87	PFAM
Pfam:Aldedh	536	753	2.7e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209581

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209755

Predicted Effect

probably benign
Transcript: ENSMUST00000209957

Predicted Effect

probably benign
Transcript: ENSMUST00000209963
AA Change: D670E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000210125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210352

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210539

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210725

Predicted Effect

probably benign
Transcript: ENSMUST00000211169

Predicted Effect

probably benign
Transcript: ENSMUST00000211362

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	C	T	3: 88,711,654	T555M	probably damaging	Het
Abcd2	A	G	15: 91,191,118	I164T	probably damaging	Het
Adad2	C	T	8: 119,614,232	P164S	probably benign	Het
Adcy3	T	A	12: 4,194,324	L278H	probably damaging	Het
Bcat1	A	G	6: 145,015,484	M131T	probably damaging	Het
D11Wsu47e	C	T	11: 113,687,998	P73L	probably damaging	Het
Dcstamp	T	C	15: 39,754,336	F47S	possibly damaging	Het
Dsg1b	T	C	18: 20,397,442	F385L	probably damaging	Het
Exoc8	A	C	8: 124,896,044	L528R	probably damaging	Het
Fat4	T	C	3: 38,957,126	V2125A	possibly damaging	Het
Hecw1	T	C	13: 14,297,283	D600G	probably damaging	Het
Ice2	G	A	9: 69,416,229	V669I	probably benign	Het
Lsr	T	A	7: 30,972,083	Y75F	possibly damaging	Het
Mrps30	C	A	13: 118,387,126	V37L	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Olfr815	T	A	10: 129,902,078	I211L	probably benign	Het
Pign	A	G	1: 105,638,181		probably null	Het
Plcd3	A	G	11: 103,073,800	Y582H	probably damaging	Het
Rad9b	A	G	5: 122,352,567	W29R	probably damaging	Het
Rb1cc1	T	A	1: 6,249,092	F912I	probably benign	Het
Rgs16	C	T	1: 153,743,800	S184L	unknown	Het
Runx2	A	G	17: 44,814,488		probably null	Het
Serpina1f	T	A	12: 103,693,535	I163F	probably damaging	Het
Serpina9	T	C	12: 103,997,037	E404G	possibly damaging	Het
Slc4a4	T	C	5: 89,149,333	S511P	possibly damaging	Het
Speg	A	T	1: 75,388,463	E390V	probably damaging	Het
Syne3	A	G	12: 104,946,707	V614A	probably benign	Het
Tmc5	T	C	7: 118,647,844	S524P	probably damaging	Het
Tuba4a	G	A	1: 75,217,286	T51I	probably damaging	Het
Tymp	T	A	15: 89,373,600	T421S	probably benign	Het
Uvssa	A	G	5: 33,392,176	R394G	possibly damaging	Het
Wdr7	T	G	18: 63,755,055	I533S	possibly damaging	Het
Zbtb5	G	A	4: 44,994,508	T292M	probably damaging	Het
Zfp944	T	G	17: 22,339,745	K174Q	possibly damaging	Het

Other mutations in Aldh16a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01394:Aldh16a1	APN	7	45145513	missense	probably benign	0.00
IGL01449:Aldh16a1	APN	7	45141967	missense	probably damaging	0.99
IGL01599:Aldh16a1	APN	7	45142093	missense	probably damaging	0.99
IGL02118:Aldh16a1	APN	7	45146035	missense	probably damaging	1.00
IGL02120:Aldh16a1	APN	7	45146035	missense	probably damaging	1.00
IGL02123:Aldh16a1	APN	7	45146035	missense	probably damaging	1.00
IGL02125:Aldh16a1	APN	7	45146035	missense	probably damaging	1.00
IGL02126:Aldh16a1	APN	7	45146035	missense	probably damaging	1.00
IGL02794:Aldh16a1	APN	7	45145594	missense	probably damaging	0.98
IGL03348:Aldh16a1	APN	7	45141975	missense	possibly damaging	0.85
G1Funyon:Aldh16a1	UTSW	7	45141982	missense	possibly damaging	0.80
R0242:Aldh16a1	UTSW	7	45144664	missense	probably damaging	1.00
R0242:Aldh16a1	UTSW	7	45144664	missense	probably damaging	1.00
R0305:Aldh16a1	UTSW	7	45147979	missense	probably damaging	1.00
R0532:Aldh16a1	UTSW	7	45142838	missense	probably damaging	1.00
R0550:Aldh16a1	UTSW	7	45146229	splice site	probably null
R0707:Aldh16a1	UTSW	7	45144507	unclassified	probably benign
R0801:Aldh16a1	UTSW	7	45147476	missense	probably benign	0.00
R1224:Aldh16a1	UTSW	7	45142047	splice site	probably null
R1371:Aldh16a1	UTSW	7	45147250	missense	possibly damaging	0.78
R1778:Aldh16a1	UTSW	7	45147308	missense	probably damaging	1.00
R2064:Aldh16a1	UTSW	7	45147161	critical splice donor site	probably null
R4616:Aldh16a1	UTSW	7	45148788	intron	probably benign
R4859:Aldh16a1	UTSW	7	45147307	missense	probably benign	0.10
R4928:Aldh16a1	UTSW	7	45141961	missense	probably damaging	1.00
R5476:Aldh16a1	UTSW	7	45142069	missense	possibly damaging	0.89
R5591:Aldh16a1	UTSW	7	45144652	missense	probably null	0.82
R5647:Aldh16a1	UTSW	7	45154465	missense	probably benign	0.00
R5692:Aldh16a1	UTSW	7	45147799	missense	probably damaging	1.00
R5698:Aldh16a1	UTSW	7	45154407	unclassified	probably benign
R5879:Aldh16a1	UTSW	7	45147506	nonsense	probably null
R5890:Aldh16a1	UTSW	7	45144545	missense	probably benign	0.00
R6321:Aldh16a1	UTSW	7	45149765	missense	probably damaging	1.00
R6338:Aldh16a1	UTSW	7	45141961	missense	probably damaging	1.00
R6373:Aldh16a1	UTSW	7	45146271	missense	probably benign	0.00
R6497:Aldh16a1	UTSW	7	45144937	missense	possibly damaging	0.93
R7248:Aldh16a1	UTSW	7	45145594	missense	probably damaging	0.98
R7303:Aldh16a1	UTSW	7	45147904	missense	probably damaging	1.00
R7467:Aldh16a1	UTSW	7	45145907	missense	probably benign	0.03
R7636:Aldh16a1	UTSW	7	45147531	missense	unknown
R7830:Aldh16a1	UTSW	7	45146225	missense	probably damaging	0.98
R8301:Aldh16a1	UTSW	7	45141982	missense	possibly damaging	0.80
R8444:Aldh16a1	UTSW	7	45149691	missense	probably benign	0.00
R8801:Aldh16a1	UTSW	7	45142014	missense	probably benign
R9011:Aldh16a1	UTSW	7	45145527	missense	probably damaging	0.98
R9187:Aldh16a1	UTSW	7	45142017	missense	probably damaging	0.99
R9620:Aldh16a1	UTSW	7	45147989	nonsense	probably null
Z1177:Aldh16a1	UTSW	7	45145903	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCGTTATCATAGCTACCCAGG -3'
(R):5'- TCCCCTGGTTACACATTATGGAG -3'

Sequencing Primer
(F):5'- GGAGGAGGCCAGCTGAGC -3'
(R):5'- CACATTATGGAGCTACTCTGGAGC -3'

Posted On

2018-06-06