Incidental Mutation 'R6489:Utp15'
ID522678
Institutional Source Beutler Lab
Gene Symbol Utp15
Ensembl Gene ENSMUSG00000041747
Gene NameUTP15 small subunit processome component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6489 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location98246845-98263041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98250609 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 434 (F434L)
Ref Sequence ENSEMBL: ENSMUSP00000048204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040972]
Predicted Effect probably damaging
Transcript: ENSMUST00000040972
AA Change: F434L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747
AA Change: F434L

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225100
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.3%
  • 20x: 90.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,010,319 T650A probably benign Het
Alkbh7 T A 17: 56,998,979 S127T probably damaging Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
App G T 16: 85,056,520 D223E unknown Het
Arhgef2 C A 3: 88,643,014 S675R probably damaging Het
Atg14 T C 14: 47,549,023 D258G probably damaging Het
Ckap2l T C 2: 129,269,114 D721G possibly damaging Het
Cog8 T C 8: 107,050,301 T481A probably benign Het
Colec10 C A 15: 54,462,213 probably null Het
Dhx9 T C 1: 153,456,643 probably benign Het
Dock1 T C 7: 134,990,541 M935T probably damaging Het
Dsg4 T A 18: 20,471,363 N962K possibly damaging Het
Dym T C 18: 75,080,226 V173A probably benign Het
Exoc3l4 A G 12: 111,428,697 Y583C probably damaging Het
Fam26e A T 10: 34,092,506 W184R probably damaging Het
Flnb G A 14: 7,867,551 V103M probably damaging Het
Fzd1 T A 5: 4,757,336 Q82L probably benign Het
Gabrr1 A G 4: 33,162,855 I474V probably benign Het
Galnt11 G T 5: 25,264,966 W521L probably damaging Het
Glb1l3 A G 9: 26,826,831 V420A probably benign Het
Gm5678 A T 16: 93,630,398 probably null Het
H1fnt A T 15: 98,257,007 L87* probably null Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Ihh T A 1: 74,946,511 T272S probably damaging Het
Il27ra T C 8: 84,031,550 M524V probably benign Het
Lman1l A T 9: 57,613,726 probably null Het
Mdp1 C A 14: 55,660,391 probably benign Het
Med12l A G 3: 59,257,407 K1436R probably damaging Het
Megf10 C T 18: 57,291,807 S1006F probably benign Het
Miga1 A T 3: 152,279,008 I426N probably damaging Het
Mtmr6 C T 14: 60,300,514 T654I possibly damaging Het
Nbeal1 A G 1: 60,330,942 S2673G possibly damaging Het
Nup93 T A 8: 94,302,088 H193Q probably benign Het
Olfr1303 A C 2: 111,814,060 L222W probably damaging Het
Olfr384 T A 11: 73,603,439 N286K probably damaging Het
Olfr629 T C 7: 103,740,668 N191D probably benign Het
Pdcd11 C T 19: 47,109,752 R826C probably damaging Het
Pde4dip G A 3: 97,755,591 R521* probably null Het
Phf2 T C 13: 48,826,182 S158G unknown Het
Pla2g15 A G 8: 106,163,194 E366G probably benign Het
Plekhm2 A T 4: 141,632,033 H494Q probably damaging Het
Prpsap2 A T 11: 61,749,064 M87K probably damaging Het
Rbm19 T G 5: 120,120,130 S137A probably benign Het
Ryr2 T A 13: 11,834,007 I363L probably benign Het
Samd9l T C 6: 3,376,896 T122A probably benign Het
Scn4a G C 11: 106,349,180 D70E probably benign Het
Slc12a3 T A 8: 94,335,004 V293D possibly damaging Het
Slc6a7 T C 18: 61,007,543 Y139C probably damaging Het
Slco2b1 A T 7: 99,690,555 C9* probably null Het
Slitrk1 A T 14: 108,911,303 S659T possibly damaging Het
Son T G 16: 91,655,156 S264A possibly damaging Het
Svep1 C A 4: 58,100,066 G1326V probably damaging Het
Tcf12 A G 9: 72,015,636 probably null Het
Ttn A G 2: 76,814,718 V11185A probably damaging Het
Ubap2 T C 4: 41,203,574 probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vsnl1 T G 12: 11,332,218 probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb34 A C 2: 33,411,546 S328A probably damaging Het
Zdbf2 T C 1: 63,307,478 I1672T possibly damaging Het
Other mutations in Utp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Utp15 APN 13 98257952 missense probably damaging 1.00
IGL02960:Utp15 APN 13 98252881 missense probably benign 0.30
IGL03271:Utp15 APN 13 98253694 missense probably damaging 1.00
R0125:Utp15 UTSW 13 98250882 missense possibly damaging 0.81
R0679:Utp15 UTSW 13 98259403 missense probably benign 0.13
R1447:Utp15 UTSW 13 98252878 missense possibly damaging 0.68
R1618:Utp15 UTSW 13 98257187 missense probably benign 0.16
R1992:Utp15 UTSW 13 98250912 missense probably benign
R2110:Utp15 UTSW 13 98254985 missense probably damaging 1.00
R2263:Utp15 UTSW 13 98257925 missense probably benign 0.03
R3888:Utp15 UTSW 13 98259166 missense probably benign 0.00
R4355:Utp15 UTSW 13 98259247 missense possibly damaging 0.48
R5436:Utp15 UTSW 13 98260846 unclassified probably null
R5568:Utp15 UTSW 13 98257925 missense probably benign 0.03
R8116:Utp15 UTSW 13 98250863 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATTGTGACTGCACCCAC -3'
(R):5'- TGGCATAGGTCCTCCGTTAC -3'

Sequencing Primer
(F):5'- TGTGACTGCACCCACACCTC -3'
(R):5'- TTACTGCCCGGTGAGAGAC -3'
Posted On2018-06-06