Incidental Mutation 'R6566:Adad2'
ID522681
Institutional Source Beutler Lab
Gene Symbol Adad2
Ensembl Gene ENSMUSG00000024266
Gene Nameadenosine deaminase domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6566 (G1)
Quality Score111.008
Status Validated
Chromosome8
Chromosomal Location119612747-119616924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119614232 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 164 (P164S)
Ref Sequence ENSEMBL: ENSMUSP00000095964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098361]
Predicted Effect probably benign
Transcript: ENSMUST00000098361
AA Change: P164S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095964
Gene: ENSMUSG00000024266
AA Change: P164S

DomainStartEndE-ValueType
DSRM 94 158 4e-7 SMART
ADEAMc 185 560 2.7e-37 SMART
Meta Mutation Damage Score 0.2127 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,711,654 T555M probably damaging Het
Abcd2 A G 15: 91,191,118 I164T probably damaging Het
Adcy3 T A 12: 4,194,324 L278H probably damaging Het
Aldh16a1 A C 7: 45,143,227 D670E probably benign Het
Bcat1 A G 6: 145,015,484 M131T probably damaging Het
D11Wsu47e C T 11: 113,687,998 P73L probably damaging Het
Dcstamp T C 15: 39,754,336 F47S possibly damaging Het
Dsg1b T C 18: 20,397,442 F385L probably damaging Het
Exoc8 A C 8: 124,896,044 L528R probably damaging Het
Fat4 T C 3: 38,957,126 V2125A possibly damaging Het
Hecw1 T C 13: 14,297,283 D600G probably damaging Het
Ice2 G A 9: 69,416,229 V669I probably benign Het
Lsr T A 7: 30,972,083 Y75F possibly damaging Het
Mrps30 C A 13: 118,387,126 V37L probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr815 T A 10: 129,902,078 I211L probably benign Het
Pign A G 1: 105,638,181 probably null Het
Plcd3 A G 11: 103,073,800 Y582H probably damaging Het
Rad9b A G 5: 122,352,567 W29R probably damaging Het
Rb1cc1 T A 1: 6,249,092 F912I probably benign Het
Rgs16 C T 1: 153,743,800 S184L unknown Het
Runx2 A G 17: 44,814,488 probably null Het
Serpina1f T A 12: 103,693,535 I163F probably damaging Het
Serpina9 T C 12: 103,997,037 E404G possibly damaging Het
Slc4a4 T C 5: 89,149,333 S511P possibly damaging Het
Speg A T 1: 75,388,463 E390V probably damaging Het
Syne3 A G 12: 104,946,707 V614A probably benign Het
Tmc5 T C 7: 118,647,844 S524P probably damaging Het
Tuba4a G A 1: 75,217,286 T51I probably damaging Het
Tymp T A 15: 89,373,600 T421S probably benign Het
Uvssa A G 5: 33,392,176 R394G possibly damaging Het
Wdr7 T G 18: 63,755,055 I533S possibly damaging Het
Zbtb5 G A 4: 44,994,508 T292M probably damaging Het
Zfp944 T G 17: 22,339,745 K174Q possibly damaging Het
Other mutations in Adad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Adad2 APN 8 119616669 missense probably damaging 1.00
IGL02385:Adad2 APN 8 119615034 splice site probably benign
R0619:Adad2 UTSW 8 119613000 missense probably benign 0.01
R3410:Adad2 UTSW 8 119615969 missense probably benign
R4961:Adad2 UTSW 8 119615658 missense probably damaging 0.99
R5479:Adad2 UTSW 8 119614915 missense possibly damaging 0.93
R5521:Adad2 UTSW 8 119612789 missense probably benign 0.43
R5610:Adad2 UTSW 8 119614761 missense probably benign 0.00
R5624:Adad2 UTSW 8 119615105 splice site probably null
R6237:Adad2 UTSW 8 119615763 missense probably damaging 1.00
R8069:Adad2 UTSW 8 119616007 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCGACTAGAAATGGTCCAGC -3'
(R):5'- TCCATGCTGACGTCTAGGAG -3'

Sequencing Primer
(F):5'- CTGAGGGCCAGGAGACTTCTC -3'
(R):5'- TGTGGAGCTGCACACACATAC -3'
Posted On2018-06-06