Incidental Mutation 'R6566:Dcstamp'
ID522705
Institutional Source Beutler Lab
Gene Symbol Dcstamp
Ensembl Gene ENSMUSG00000022303
Gene Namedendrocyte expressed seven transmembrane protein
SynonymsTm7sf4, 4833414I07Rik, DC-STAMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R6566 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location39745930-39760938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39754336 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 47 (F47S)
Ref Sequence ENSEMBL: ENSMUSP00000153957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022913] [ENSMUST00000227368] [ENSMUST00000227792] [ENSMUST00000228556] [ENSMUST00000228701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022913
AA Change: F47S

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022913
Gene: ENSMUSG00000022303
AA Change: F47S

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 58 75 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Pfam:DC_STAMP 242 421 1e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227368
AA Change: F47S

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227792
AA Change: F47S

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228556
AA Change: F47S

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228701
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Targeted disruption of this gene causes complete loss of osteoclast and macrophage cell fusion and leads to reduced bone-resorbing activity and mild osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,711,654 T555M probably damaging Het
Abcd2 A G 15: 91,191,118 I164T probably damaging Het
Adad2 C T 8: 119,614,232 P164S probably benign Het
Adcy3 T A 12: 4,194,324 L278H probably damaging Het
Aldh16a1 A C 7: 45,143,227 D670E probably benign Het
Bcat1 A G 6: 145,015,484 M131T probably damaging Het
D11Wsu47e C T 11: 113,687,998 P73L probably damaging Het
Dsg1b T C 18: 20,397,442 F385L probably damaging Het
Exoc8 A C 8: 124,896,044 L528R probably damaging Het
Fat4 T C 3: 38,957,126 V2125A possibly damaging Het
Hecw1 T C 13: 14,297,283 D600G probably damaging Het
Ice2 G A 9: 69,416,229 V669I probably benign Het
Lsr T A 7: 30,972,083 Y75F possibly damaging Het
Mrps30 C A 13: 118,387,126 V37L probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr815 T A 10: 129,902,078 I211L probably benign Het
Pign A G 1: 105,638,181 probably null Het
Plcd3 A G 11: 103,073,800 Y582H probably damaging Het
Rad9b A G 5: 122,352,567 W29R probably damaging Het
Rb1cc1 T A 1: 6,249,092 F912I probably benign Het
Rgs16 C T 1: 153,743,800 S184L unknown Het
Runx2 A G 17: 44,814,488 probably null Het
Serpina1f T A 12: 103,693,535 I163F probably damaging Het
Serpina9 T C 12: 103,997,037 E404G possibly damaging Het
Slc4a4 T C 5: 89,149,333 S511P possibly damaging Het
Speg A T 1: 75,388,463 E390V probably damaging Het
Syne3 A G 12: 104,946,707 V614A probably benign Het
Tmc5 T C 7: 118,647,844 S524P probably damaging Het
Tuba4a G A 1: 75,217,286 T51I probably damaging Het
Tymp T A 15: 89,373,600 T421S probably benign Het
Uvssa A G 5: 33,392,176 R394G possibly damaging Het
Wdr7 T G 18: 63,755,055 I533S possibly damaging Het
Zbtb5 G A 4: 44,994,508 T292M probably damaging Het
Zfp944 T G 17: 22,339,745 K174Q possibly damaging Het
Other mutations in Dcstamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Dcstamp APN 15 39754416 missense probably benign 0.05
IGL01963:Dcstamp APN 15 39760359 missense possibly damaging 0.82
IGL02132:Dcstamp APN 15 39754532 missense probably damaging 0.97
IGL02139:Dcstamp APN 15 39754458 missense probably damaging 1.00
IGL02607:Dcstamp APN 15 39754584 missense possibly damaging 0.94
IGL03003:Dcstamp APN 15 39754510 missense possibly damaging 0.64
IGL03061:Dcstamp APN 15 39760397 missense possibly damaging 0.81
IGL03191:Dcstamp APN 15 39754224 missense probably benign 0.00
R1144:Dcstamp UTSW 15 39760368 missense possibly damaging 0.94
R1186:Dcstamp UTSW 15 39754629 unclassified probably null
R1663:Dcstamp UTSW 15 39754944 nonsense probably null
R2117:Dcstamp UTSW 15 39755175 nonsense probably null
R2202:Dcstamp UTSW 15 39754312 missense probably damaging 0.99
R4484:Dcstamp UTSW 15 39754224 missense probably benign 0.00
R4642:Dcstamp UTSW 15 39754722 missense probably benign 0.01
R5384:Dcstamp UTSW 15 39759319 missense probably damaging 0.99
R5529:Dcstamp UTSW 15 39754536 missense probably benign 0.04
R5558:Dcstamp UTSW 15 39759540 missense probably damaging 1.00
R5562:Dcstamp UTSW 15 39754402 missense possibly damaging 0.88
R6261:Dcstamp UTSW 15 39754735 missense possibly damaging 0.65
R6299:Dcstamp UTSW 15 39755203 missense probably damaging 1.00
R6377:Dcstamp UTSW 15 39754921 missense probably benign 0.01
R6596:Dcstamp UTSW 15 39754209 missense possibly damaging 0.95
R6869:Dcstamp UTSW 15 39754458 missense probably damaging 1.00
R7030:Dcstamp UTSW 15 39759533 missense probably damaging 0.96
R7945:Dcstamp UTSW 15 39760401 makesense probably null
R8178:Dcstamp UTSW 15 39755026 missense probably damaging 1.00
Z1177:Dcstamp UTSW 15 39759596 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATTTCTTGGTGGGAGTCCC -3'
(R):5'- GCTGTCTAGGAGACCTCTGAAG -3'

Sequencing Primer
(F):5'- TGGAACTCACCTTGTAGACCAGG -3'
(R):5'- TTTTCCACATGTCCAAAGATCAC -3'
Posted On2018-06-06